National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10174R-4 
 Symbol Ntf-2r  Full Name Nuclear transport factor-2-related 
 CG No CG10174  Old CG No CG10174 
 Synonyms Dntf-2r, CG10174, Ntf-2r 
 Accession No (Link to NCBI) NM_136034.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTCTCTGAATCTGCAGTACGA 
 Primer Seq. 3'
aatctagaggtaccAGAGTTGTGGATGTTCAGACG 
 Predicted Fragment Size
385 
 IR fragment full Seq
0001 GTCTCTGAAT CTGCAGTACG AGGACATTGG CAAGGAATTT GTCCAGCAGT ACTACGCCAT 
0061 ATTCGATGAC CCGGCGAATC GGGAGAACGT GATTAATTTC TATAACGCTA CCGACTCTTT 
0121 CATGACCTTT GAAGGCAACC AAATACAGGG AGCACCCAAG ATTCTGGAAA AAGTTCAGAG 
0181 TCTGAGCTTT CAGAAGATTG CCAGAGTGAT AACCACAGTG GATTCGCAGC CAACTTCCGA 
0241 TGGCGGAGTT CTGATCATCG TCCTTGGAAG ACTAAAATGC GATGACGATC CCCCACATGC 
0301 ATTCTCGCAG ATCTTTTTGC TGAAGCCCAA CGGAGGATCC CTCTTCGTGG CTCACGACAT 
0361 CTTCCGTCTG AACATCCACA ACTCT 
 in silico PCR Fragment
0001 GTCTCTGAAT CTGCAGTACG AGGACATTGG CAAGGAATTT GTCCAGCAGT ACTACGCCAT 
0061 ATTCGATGAC CCGGCGAATC GGGAGAACGT GATTAATTTC TATAACGCTA CCGACTCTTT 
0121 CATGACCTTT GAAGGCAACC AAATACAGGG AGCACCCAAG ATTCTGGAAA AAGTTCAGAG 
0181 TCTGAGCTTT CAGAAGATTG CCAGAGTGAT AACCACAGTG GATTCGCAGC CAACTTCCGA 
0241 TGGCGGAGTT CTGATCATCG TCCTTGGAAG ACTAAAATGC GATGACGATC CCCCACATGC 
0301 ATTCTCGCAG ATCTTTTTGC TGAAGCCCAA CGGAGGATCC CTCTTCGTGG CTCACGACAT 
0361 CTTCCGTCTG AACATCCACA ACTCT 
 Assemble Data

10174R-4.IR_full       1   GTCTCTGAATCTGCAGTACGAGGACATTGGCAAGGAATTTGTCCAGCAGTACTACGCCAT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10174R-4.in silico     1   GTCTCTGAATCTGCAGTACGAGGACATTGGCAAGGAATTTGTCCAGCAGTACTACGCCAT 60


10174R-4.IR_full       61  ATTCGATGACCCGGCGAATCGGGAGAACGTGATTAATTTCTATAACGCTACCGACTCTTT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10174R-4.in silico     61  ATTCGATGACCCGGCGAATCGGGAGAACGTGATTAATTTCTATAACGCTACCGACTCTTT 120


10174R-4.IR_full       121 CATGACCTTTGAAGGCAACCAAATACAGGGAGCACCCAAGATTCTGGAAAAAGTTCAGAG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10174R-4.in silico     121 CATGACCTTTGAAGGCAACCAAATACAGGGAGCACCCAAGATTCTGGAAAAAGTTCAGAG 180


10174R-4.IR_full       181 TCTGAGCTTTCAGAAGATTGCCAGAGTGATAACCACAGTGGATTCGCAGCCAACTTCCGA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10174R-4.in silico     181 TCTGAGCTTTCAGAAGATTGCCAGAGTGATAACCACAGTGGATTCGCAGCCAACTTCCGA 240


10174R-4.IR_full       241 TGGCGGAGTTCTGATCATCGTCCTTGGAAGACTAAAATGCGATGACGATCCCCCACATGC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10174R-4.in silico     241 TGGCGGAGTTCTGATCATCGTCCTTGGAAGACTAAAATGCGATGACGATCCCCCACATGC 300


10174R-4.IR_full       301 ATTCTCGCAGATCTTTTTGCTGAAGCCCAACGGAGGATCCCTCTTCGTGGCTCACGACAT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10174R-4.in silico     301 ATTCTCGCAGATCTTTTTGCTGAAGCCCAACGGAGGATCCCTCTTCGTGGCTCACGACAT 360


10174R-4.IR_full       361 CTTCCGTCTGAACATCCACAACTCT 385
                           |||||||||||||||||||||||||
10174R-4.in silico     361 CTTCCGTCTGAACATCCACAACTCT 385

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   367  NM_136034.1  CG10174-RA (Ntf-2r), mRNA 
14.44   53  172  106  19  NM_134578.2  CG1740-RA (Ntf-2), mRNA 
0   NM_132122.2  CG3126-RA, transcript variant A (C3G), mRNA 
0   NM_176694.1  CG3126-RB, transcript variant B (C3G), mRNA 
0   NM_142916.1  CG10301-RA (CG10301), mRNA 
0   NM_079903.2  CG15319-RB (nej), mRNA 
0   NM_142263.2  CG5013-RA (CG5013), mRNA 
0   NM_144381.1  CG15378-RA (lectin-22C), mRNA 
0   NM_142610.2  CG5023-RA (CG5023), mRNA 
0   NM_079933.3  CG5408-RA (trbl), mRNA 
0   NM_136481.1  CG1550-RA (CG1550), mRNA 
0   NM_142442.1  CG12320-RA (CG12320), mRNA 
0   NM_135187.3  CG9531-RA (CG9531), mRNA 
0   NM_141613.1  CG16733-RA (CG16733), mRNA 
0   NM_080190.2  CG4152-RA (l(2)35Df), mRNA 
0   NM_057864.3  CG9127-RA, transcript variant A (ade2), mRNA 
0   NM_164675.1  CG9127-RB, transcript variant B (ade2), mRNA 
0   NM_164676.1  CG9127-RC, transcript variant C (ade2), mRNA 
0   NM_078676.3  CG6223-RA (betaCop), mRNA 
0   NM_079764.2  CG6875-RA (asp), mRNA 
0   NM_142983.2  CG6356-RA (CG6356), mRNA 
0   NM_057618.2  CG3399-RA, transcript variant A (capu), mRNA 
0   NM_137311.2  CG8566-RD (unc-104), mRNA 
0   NM_169086.1  CG2244-RA, transcript variant A (MTA1-like), mRNA 
0   NM_141309.2  CG2244-RB, transcript variant B (MTA1-like), mRNA 
0   NM_205873.1  CG1710-RD, transcript variant D (Hcf), mRNA 
0   NM_079882.2  CG1710-RA, transcript variant A (Hcf), mRNA 
0   NM_166756.1  CG1710-RB, transcript variant B (Hcf), mRNA 
0   NM_166757.1  CG1710-RC, transcript variant C (Hcf), mRNA 
0   NM_169838.1  CG14296-RA, transcript variant A (endoA), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
+- 
DB
+- 
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
DC
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.