National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10161R-2 
 Symbol eIF-3p66  Full Name Eukaryotic initiation factor 3 p66 subunit 
 CG No CG10161  Old CG No CG10161 
 Synonyms 153314_at, eiF3p66, GM04979, CG10161, eIF3-S7, GM10514, BEST:GM10514, eIF-3p66 
 Accession No (Link to NCBI) NM_079739.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGAGCGAGACCATAAACACC 
 Primer Seq. 3'
aatctagaggtaccGAAGATTCGCGCATCTTTGGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGAGCGAGA CCATAAACAC CGCGGCTCAG TTCCCGAGCT TCGANGAAGC CGACCGTGCA 
0061 GTTCAATGAA AAGGGCTGGG GTCCCTGCGA GCTGCCCGAT ACGTTCAAGG ATGTGCCGTA 
0121 CCAGCCGTTC AGCAAAAACG ATCGTCTGGG CAAGATCTGC GACTGGACGA ATACGTCGAA 
0181 CAACGACAAG AAGTACCAGA ACAAGTATGC CTCCAGCTTT GGCACGGGCA TTCAGTACTC 
0241 GTACTACCAT GAGGAGGACG AGACGACCTT CCACCTGGTG GACACGGCCC GCGTCCAGAA 
0301 GCCGCCGCAC CAGCGCGGCC GGTTCCGCAA CATGAGGAAT TCGCGTTCCG GTCGTGGCAG 
0361 GAATGCCCGC GGTGGCCTTA ATACTCACGG CATGACGACg CTCAGCGGCA AGAATGTAAA 
0421 GGCCCGCGNA TccgCGCCAT GGTCGCGGCA TGGGCAAGAA GTTCGGTCAT CGCGGACCAC 
0481 CACCAAAGAT GCGCGAATCT TC 
 in silico PCR Fragment
0001 ATGAGCGAGA CCATAAACAC CGCGGCTCAG TTCCCGAGCT TCGA-GAAGC CGACCGTGCA 
0061 GTTCAATGAA AAGGGCTGGG GTCCCTGCGA GCTGCCCGAT ACGTTCAAGG ATGTGCCGTA 
0121 CCAGCCGTTC AGCAAGAACG ATCGTCTGGG CAAGATCTGC GACTGGACGA ATACGTCGAA 
0181 CAACGACAAG AAGTACCAGA ACAAGTATGC CTCCAGCTTT GGCACGGGCA TTCAGTACTC 
0241 GTACTACCAT GAGGAGGACG AGACAACCTT CCACCTGGTG GACACGGCCC GCGTCCAGAA 
0301 GCCGCCGCAC CAGCGCGGCC GGTTCCGCAA CATGAGGAAT TCGCGTTCCG GTCGTGGCAG 
0361 GAATGCCCGC GGTGGCCTTA ATACTCACGG CATGACGACG CTCAGCGGCA AGAATGTAAA 
0421 GGCCCGCG-A TCCGCGCCAT GGTCGCGGCA TGGGCAAGAA GTTCGGTCAT CGCGGACCAC 
0481 CACCAAAGAT GCGCGAATCT TC 
 Assemble Data

10161R-2.IR_full       1   ATGAGCGAGACCATAAACACCGCGGCTCAGTTCCCGAGCTTCGANGAAGCCGACCGTGCA 60
                           |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
10161R-2.in silico     1   ATGAGCGAGACCATAAACACCGCGGCTCAGTTCCCGAGCTTCGA-GAAGCCGACCGTGCA 60


10161R-2.IR_full       61  GTTCAATGAAAAGGGCTGGGGTCCCTGCGAGCTGCCCGATACGTTCAAGGATGTGCCGTA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10161R-2.in silico     61  GTTCAATGAAAAGGGCTGGGGTCCCTGCGAGCTGCCCGATACGTTCAAGGATGTGCCGTA 120


10161R-2.IR_full       121 CCAGCCGTTCAGCAAAAACGATCGTCTGGGCAAGATCTGCGACTGGACGAATACGTCGAA 180
                           ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
10161R-2.in silico     121 CCAGCCGTTCAGCAAGAACGATCGTCTGGGCAAGATCTGCGACTGGACGAATACGTCGAA 180


10161R-2.IR_full       181 CAACGACAAGAAGTACCAGAACAAGTATGCCTCCAGCTTTGGCACGGGCATTCAGTACTC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10161R-2.in silico     181 CAACGACAAGAAGTACCAGAACAAGTATGCCTCCAGCTTTGGCACGGGCATTCAGTACTC 240


10161R-2.IR_full       241 GTACTACCATGAGGAGGACGAGACGACCTTCCACCTGGTGGACACGGCCCGCGTCCAGAA 300
                           |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
10161R-2.in silico     241 GTACTACCATGAGGAGGACGAGACAACCTTCCACCTGGTGGACACGGCCCGCGTCCAGAA 300


10161R-2.IR_full       301 GCCGCCGCACCAGCGCGGCCGGTTCCGCAACATGAGGAATTCGCGTTCCGGTCGTGGCAG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10161R-2.in silico     301 GCCGCCGCACCAGCGCGGCCGGTTCCGCAACATGAGGAATTCGCGTTCCGGTCGTGGCAG 360


10161R-2.IR_full       361 GAATGCCCGCGGTGGCCTTAATACTCACGGCATGACGACGCTCAGCGGCAAGAATGTAAA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10161R-2.in silico     361 GAATGCCCGCGGTGGCCTTAATACTCACGGCATGACGACGCTCAGCGGCAAGAATGTAAA 420


10161R-2.IR_full       421 GGCCCGCGNATCCGCGCCATGGTCGCGGCATGGGCAAGAAGTTCGGTCATCGCGGACCAC 480
                           |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||
10161R-2.in silico     421 GGCCCGCG-ATCCGCGCCATGGTCGCGGCATGGGCAAGAAGTTCGGTCATCGCGGACCAC 480


10161R-2.IR_full       481 CACCAAAGATGCGCGAATCTTC 502
                           ||||||||||||||||||||||
10161R-2.in silico     481 CACCAAAGATGCGCGAATCTTC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079739.2  CG10161-RB (eIF-3p66), mRNA 
1.03   11  15  17  NM_169456.1  CG4810-RA (CG4810), mRNA 
0   NM_165485.1  CG9432-RB, transcript variant B (l(2)01289), mRNA 
0   NM_001043010.1  CG9432-RD, transcript variant D (l(2)01289), mRNA 
0   NM_168069.1  CG15009-RB, transcript variant B (ImpL2), mRNA 
0   NM_079566.3  CG9359-RA (betaTub85D), mRNA 
0   NM_135388.2  CG9233-RA (fu2), mRNA 
0   NM_169697.2  CG3978-RB, transcript variant B (pnr), mRNA 
0   NM_206412.1  CG10508-RF, transcript variant F (CG10508), mRNA 
0   NM_176384.2  CG10508-RC, transcript variant C (CG10508), mRNA 
0   NM_142604.1  CG4413-RA (CG4413), mRNA 
0   NM_206141.1  CG33456-RA (CG33456), mRNA 
0   NM_133012.2  CG32560-RA (CG32560), mRNA 
0   NM_176728.1  CG33174-RA, transcript variant A (CG33174), mRNA 
0   NM_176727.1  CG33174-RD, transcript variant D (CG33174), mRNA 
0   NM_137099.2  CG8494-RA (CG8494), mRNA 
0   NM_136395.1  CG3450-RA (ubl), mRNA 
0   NM_132569.1  CG11245-RA (CG11245), mRNA 
0   NM_176223.2  CG30115-RD, transcript variant D (CG30115), mRNA 
0   NM_206591.1  CG1447-RC, transcript variant C (Ptx1), mRNA 
0   NM_170531.3  CG1447-RA, transcript variant A (Ptx1), mRNA 
0   NM_176593.1  CG1447-RB, transcript variant B (Ptx1), mRNA 
0   NM_141083.2  CG11306-RA (CG11306), mRNA 
0   NM_167553.1  CG9059-RA, transcript variant A (CG9059), mRNA 
0   NM_141012.1  CG10589-RA (CG10589), mRNA 
0   NM_132957.1  CG9059-RB, transcript variant B (CG9059), mRNA 
0   NM_165189.1  CG17927-RB, transcript variant B (Mhc), mRNA 
0   NM_165192.1  CG17927-RM, transcript variant M (Mhc), mRNA 
0   NM_165191.1  CG17927-RL, transcript variant L (Mhc), mRNA 
0   NM_165190.1  CG17927-RK, transcript variant K (Mhc), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
++ 
DB
++ 
DC
++ 
DM
++ 
VM
VB
 
Caspase-3 signal
N
++ 
DB
++ 
DC
++ 
DM
++ 
VM
VB
 
Dcompartment   Penetrance
++     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.