National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10159R-2 
 Symbol BEAF-32  Full Name Boundary element-associated factor of 32kD 
 CG No CG10159  Old CG No CG10159 
 Synonyms Beaf-32, BEAF32B, BEAF32A, BEAF32, BEAF-32A, BEAF, CG10159, BEAF-32B, bs04c01.y1, BEAF-32 
 Accession No (Link to NCBI) NM_079023.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGCGGCAAAACTGGAACCGGA 
 Primer Seq. 3'
aatctagaggtaccATGTAGCTGAGCTGTTCGCTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGCGGCAAAA CTGGAACCGG ATCCCTGCTA CGGCACCGAT GTCTCCACTC CAGCAGCAGT 
0061 AACGACAAAA CCGTGCGGAT TACCAAGGCC AAGACGCTGA GGGAGCCGCT GCGTGTGGCC 
0121 AAGCCGAAGA TCGAGTCGAA CGTCGCCAAT TATCTGGGCG AGGCGGGCGC CCTGCCGCAA 
0181 AAGTGGGAGG AGTACGAGCA GAACGATGAG ATTAGCGAGG ACATTAAGGA CATCATATAC 
0241 AGCGAGGATC CACTGTGCTA TAGTCCTATA CACGTGATGG ATGATGAGGG CCTGGATCAG 
0301 CCTGAGAAGC AAGTGACCGT GCTAACCCAT TCGACTTCAC CAGCCGGTGG AAGTAGCAGG 
0361 CCCATCGGTG TTGGTTCGGG CGTACAGGCT ACTGTGGTGG CCTCCACGTC CTCCAGCAGC 
0421 AGCTCGGCCA AGCAGCTGAA GAACAACCTG GAGACGTCCA TCGAACGGCT GACCGCTGTC 
0481 AGCGAACAGC TCAGCTACAT  
 in silico PCR Fragment
0001 AGCGGCAAAA CTGGAACCGG ATCCCTGCTA CGGCACCGAT GTCTCCACTC CAGCAGCAGT 
0061 AACGACAAAA CCGTGCGGAT TACCAAGGCC AAGACGCTGA GGGAGCCGCT GCGTGTGGCC 
0121 AAGCCGAAGA TCGAGTCGAA CGTCGCCAAT TATCTGGGCG AGGCGGGCGC CCTGCCGCAA 
0181 AAGTGGGAGG AGTACGAGCA GAACGATGAG ATTAGCGAGG ACATTAAGGA CATCATATAC 
0241 AGCGAGGATC CACTGTGCTA TAGTCCTATA CACGTGATGG ATGATGAGGG CCTGGATCAG 
0301 CCTGAGAAGC AAGTGACCGT GCTAACCCAT TCGACTTCAC CAGCCGGTGG AAGTAGCAGG 
0361 CCCATCGGTG TTGGTTCGGG CGTACAGGCT ACTGTGGTGG CCTCCACGTC CTCCAGCAGC 
0421 AGCTCGGCCA AGCAGCTGAA GAACAACCTG GAGACGTCCA TCGAACGGCT GACCGCTGTC 
0481 AGCGAACAGC TCAGCTACAT  
 Assemble Data

10159R-2.IR_full       1   AGCGGCAAAACTGGAACCGGATCCCTGCTACGGCACCGATGTCTCCACTCCAGCAGCAGT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10159R-2.in silico     1   AGCGGCAAAACTGGAACCGGATCCCTGCTACGGCACCGATGTCTCCACTCCAGCAGCAGT 60


10159R-2.IR_full       61  AACGACAAAACCGTGCGGATTACCAAGGCCAAGACGCTGAGGGAGCCGCTGCGTGTGGCC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10159R-2.in silico     61  AACGACAAAACCGTGCGGATTACCAAGGCCAAGACGCTGAGGGAGCCGCTGCGTGTGGCC 120


10159R-2.IR_full       121 AAGCCGAAGATCGAGTCGAACGTCGCCAATTATCTGGGCGAGGCGGGCGCCCTGCCGCAA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10159R-2.in silico     121 AAGCCGAAGATCGAGTCGAACGTCGCCAATTATCTGGGCGAGGCGGGCGCCCTGCCGCAA 180


10159R-2.IR_full       181 AAGTGGGAGGAGTACGAGCAGAACGATGAGATTAGCGAGGACATTAAGGACATCATATAC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10159R-2.in silico     181 AAGTGGGAGGAGTACGAGCAGAACGATGAGATTAGCGAGGACATTAAGGACATCATATAC 240


10159R-2.IR_full       241 AGCGAGGATCCACTGTGCTATAGTCCTATACACGTGATGGATGATGAGGGCCTGGATCAG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10159R-2.in silico     241 AGCGAGGATCCACTGTGCTATAGTCCTATACACGTGATGGATGATGAGGGCCTGGATCAG 300


10159R-2.IR_full       301 CCTGAGAAGCAAGTGACCGTGCTAACCCATTCGACTTCACCAGCCGGTGGAAGTAGCAGG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10159R-2.in silico     301 CCTGAGAAGCAAGTGACCGTGCTAACCCATTCGACTTCACCAGCCGGTGGAAGTAGCAGG 360


10159R-2.IR_full       361 CCCATCGGTGTTGGTTCGGGCGTACAGGCTACTGTGGTGGCCTCCACGTCCTCCAGCAGC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10159R-2.in silico     361 CCCATCGGTGTTGGTTCGGGCGTACAGGCTACTGTGGTGGCCTCCACGTCCTCCAGCAGC 420


10159R-2.IR_full       421 AGCTCGGCCAAGCAGCTGAAGAACAACCTGGAGACGTCCATCGAACGGCTGACCGCTGTC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10159R-2.in silico     421 AGCTCGGCCAAGCAGCTGAAGAACAACCTGGAGACGTCCATCGAACGGCTGACCGCTGTC 480


10159R-2.IR_full       481 AGCGAACAGCTCAGCTACAT 500
                           ||||||||||||||||||||
10159R-2.in silico     481 AGCGAACAGCTCAGCTACAT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079023.2  CG10159-RA, transcript variant A (BEAF-32), mRNA 
86.92   419  NM_166069.1  CG10159-RB, transcript variant B (BEAF-32), mRNA 
9.54   46  NR_001735.1  CR30478, miscRNA 
0   NM_132421.2  CG1826-RA (CG1826), mRNA 
0   NM_142354.1  CG4090-RA (CG4090), mRNA 
0   NM_136222.3  CG14402-RA (CG14402), mRNA 
0   NM_140333.2  CG4069-RA (CG4069), mRNA 
0   NM_079208.2  CG4633-RA (Aats-ala-m), mRNA 
0   13  NM_057849.3  CG3733-RA (Chd1), mRNA 
0   NM_001038734.1  CG16902-RC (Hr4), mRNA 
0   NM_170258.2  CG32474-RA (dys), mRNA 
0   NM_166983.1  CG13316-RA, transcript variant A (Mnt), mRNA 
0   NM_166984.1  CG13316-RC, transcript variant C (Mnt), mRNA 
0   NM_130715.2  CG13316-RB, transcript variant B (Mnt), mRNA 
0   NM_079237.1  CG4321-RA (Cyp4d8), mRNA 
0   NM_166164.2  CG8048-RD, transcript variant D (Vha44), mRNA 
0   NM_057601.2  CG2851-RA (Gsc), mRNA 
0   18  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   NM_057918.3  CG8048-RA, transcript variant A (Vha44), mRNA 
0   NM_134313.2  CG8048-RB, transcript variant B (Vha44), mRNA 
0   NM_166163.1  CG8048-RC, transcript variant C (Vha44), mRNA 
0   NM_136154.1  CG10631-RA (CG10631), mRNA 
0   NM_165597.1  CG8705-RB, transcript variant B (pnut), mRNA 
0   NM_057716.3  CG8705-RA, transcript variant A (pnut), mRNA 
0   NM_206613.1  CG2621-RJ, transcript variant J (sgg), mRNA 
0   NM_057366.3  CG2621-RA, transcript variant A (sgg), mRNA 
0   NM_166948.1  CG2621-RF, transcript variant F (sgg), mRNA 
0   NM_166947.1  CG2621-RE, transcript variant E (sgg), mRNA 
0   NM_057367.3  CG2621-RB, transcript variant B (sgg), mRNA 
0   NM_206614.1  CG2621-RI, transcript variant I (sgg), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.