National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10159R-1 
 Symbol BEAF-32  Full Name Boundary element-associated factor of 32kD 
 CG No CG10159  Old CG No CG10159 
 Synonyms Beaf-32, BEAF32B, BEAF32A, BEAF32, BEAF-32A, BEAF, CG10159, BEAF-32B, bs04c01.y1, BEAF-32 
 Accession No (Link to NCBI) NM_079023.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
[Please submit your publication]
Bauke AC, Sasse S, Matzat T, Klämbt C.
A transcriptional network controlling glial development in the Drosophila visual system.
Development (2015) 142(12) 2184-93 [ PubMed ID = 26015542 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   AGCGGCAAAACTGGAACCGGATCCCTGCTACGGCACCGATGTCTCCACTCCAGCAGCAGT 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AACGACAAAACCGTGCGGATTACCAAGGCCAAGACGCTGAGGGAGCCGCTGCGTGTGGCC 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AAGCCGAAGATCGAGTCGAACGTCGCCAATTATCTGGGCGAGGCGGGCGCCCTGCCGCAA 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 AAGTGGGAGGAGTACGAGCAGAACGATGAGATTAGCGAGGACATTAAGGACATCATATAC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AGCGAGGATCCACTGTGCTATAGTCCTATACACGTGATGGATGATGAGGGCCTGGATCAG 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CCTGAGAAGCAAGTGACCGTGCTAACCCATTCGACTTCACCAGCCGGTGGAAGTAGCAGG 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CCCATCGGTGTTGGTTCGGGCGTACAGGCTACTGTGGTGGCCTCCACGTCCTCCAGCAGC 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AGCTCGGCCAAGCAGCTGAAGAACAACCTGGAGACGTCCATCGAACGGCTGACCGCTGTC 480

10159R-1.IR_full       481 AGCGAACAGCTCAGCTACAT 500
                           |||||||||||||||||||| silico     481 AGCGAACAGCTCAGCTACAT 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079023.2  CG10159-RA, transcript variant A (BEAF-32), mRNA 
86.92   419  NM_166069.1  CG10159-RB, transcript variant B (BEAF-32), mRNA 
9.54   46  NR_001735.1  CR30478, miscRNA 
0   NM_132421.2  CG1826-RA (CG1826), mRNA 
0   NM_142354.1  CG4090-RA (CG4090), mRNA 
0   NM_136222.3  CG14402-RA (CG14402), mRNA 
0   NM_140333.2  CG4069-RA (CG4069), mRNA 
0   NM_079208.2  CG4633-RA (Aats-ala-m), mRNA 
0   13  NM_057849.3  CG3733-RA (Chd1), mRNA 
0   NM_001038734.1  CG16902-RC (Hr4), mRNA 
0   NM_170258.2  CG32474-RA (dys), mRNA 
0   NM_166983.1  CG13316-RA, transcript variant A (Mnt), mRNA 
0   NM_166984.1  CG13316-RC, transcript variant C (Mnt), mRNA 
0   NM_130715.2  CG13316-RB, transcript variant B (Mnt), mRNA 
0   NM_079237.1  CG4321-RA (Cyp4d8), mRNA 
0   NM_166164.2  CG8048-RD, transcript variant D (Vha44), mRNA 
0   NM_057601.2  CG2851-RA (Gsc), mRNA 
0   18  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   NM_057918.3  CG8048-RA, transcript variant A (Vha44), mRNA 
0   NM_134313.2  CG8048-RB, transcript variant B (Vha44), mRNA 
0   NM_166163.1  CG8048-RC, transcript variant C (Vha44), mRNA 
0   NM_136154.1  CG10631-RA (CG10631), mRNA 
0   NM_165597.1  CG8705-RB, transcript variant B (pnut), mRNA 
0   NM_057716.3  CG8705-RA, transcript variant A (pnut), mRNA 
0   NM_206613.1  CG2621-RJ, transcript variant J (sgg), mRNA 
0   NM_057366.3  CG2621-RA, transcript variant A (sgg), mRNA 
0   NM_166948.1  CG2621-RF, transcript variant F (sgg), mRNA 
0   NM_166947.1  CG2621-RE, transcript variant E (sgg), mRNA 
0   NM_057367.3  CG2621-RB, transcript variant B (sgg), mRNA 
0   NM_206614.1  CG2621-RI, transcript variant I (sgg), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.