National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10125R-2 
 Symbol zpg  Full Name zero population growth 
 CG No CG10125  Old CG No CG10125 
 Synonyms inx-4, inx4, CG10125, Dm-inx4, zpg 
 Accession No (Link to NCBI) NM_139792.2 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTGTTAAACCGCTCTCCAAGT 
 Primer Seq. 3'
aatctagaggtaccATCGCTGGAGAAGTAGTTGAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CTGTTAAACC GCTCTCCAAG TATCTGCAGT TCAAGTCGGT GCACATCTAC GATGCTATTT 
0061 TCACGCTGCA CTCCAAAGTC ACAGTGGCCC TGCTTTTGGC CTGCACATTT TTGCTTTCCT 
0121 CGAAACAATA TTTCGGCGAT CCCATCCAGT GTTTTGGGGA CAAGGATATG GACTACGTGC 
0181 ACGCCTNTTT GCTGGATCTA CGGGGCCTAT GTAAGCGACA ATGTGACTGT GACGCCCCTA 
0241 AGGAATGGAG CTGCACAGTG CCGACCAGAT GCGGTTAGTA AGGTAGTGCC CCCGGAAAAT 
0301 CGTAACTACA TAACCTACTA TCAGTGGGTC GTGCTGGTAT TGCTGCTCGA GTCGTTTGTG 
0361 TTTTATATGC CAGCATTTCT CTGGAAGATT TGGGAGGGCG GTCGGCTGAA GCATTTGTGC 
0421 GATGATTTCC ACAAGATGGC CGTTTGCAAG GACAAGAGCA GGACCCATTT GCGCGTACTA 
0481 GTCAACTACT TCTCCAGCGA T 
 in silico PCR Fragment
0001 CTGTTAAACC GCTCTCCAAG TATCTGCAGT TCAAGTCGGT GCACATCTAC GATGCTATTT 
0061 TCACGCTGCA CTCCAAAGTC ACAGTGGCCC TGCTTTTGGC CTGCACATTT TTGCTTTCCT 
0121 CGAAACAATA TTTCGGCGAT CCCATCCAGT GTTTTGGGGA CAAGGATATG GACTACGTGC 
0181 ACGCCT-TTT GTTGGATCTA CGGGGCCTAT GTGAGCGACA ATGTGACTGT GACGCCCCTA 
0241 AGGAATGGAG CTGCACAGTG CCGACCAGAT GCGGTTAGTA AGGTAGTGCC CCCGGAAAAT 
0301 CGTAACTACA TAACCTACTA TCAGTGGGTC GTGCTGGTAT TGCTGCTCGA GTCGTTTGTG 
0361 TTTTATATGC CAGCATTTCT CTGGAAGATT TGGGAGGGCG GTCGGCTGAA GCATTTGTGC 
0421 GATGATTTCC ACAAGATGGC CGTTTGCAAG GACAAGAGCA GGACCCATTT GCGCGTACTA 
0481 GTCAACTACT TCTCCAGCGA T 
 Assemble Data

10125R-2.IR_full       1   CTGTTAAACCGCTCTCCAAGTATCTGCAGTTCAAGTCGGTGCACATCTACGATGCTATTT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10125R-2.in silico     1   CTGTTAAACCGCTCTCCAAGTATCTGCAGTTCAAGTCGGTGCACATCTACGATGCTATTT 60


10125R-2.IR_full       61  TCACGCTGCACTCCAAAGTCACAGTGGCCCTGCTTTTGGCCTGCACATTTTTGCTTTCCT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10125R-2.in silico     61  TCACGCTGCACTCCAAAGTCACAGTGGCCCTGCTTTTGGCCTGCACATTTTTGCTTTCCT 120


10125R-2.IR_full       121 CGAAACAATATTTCGGCGATCCCATCCAGTGTTTTGGGGACAAGGATATGGACTACGTGC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10125R-2.in silico     121 CGAAACAATATTTCGGCGATCCCATCCAGTGTTTTGGGGACAAGGATATGGACTACGTGC 180


10125R-2.IR_full       181 ACGCCTNTTTGCTGGATCTACGGGGCCTATGTAAGCGACAATGTGACTGTGACGCCCCTA 240
                           |||||| |||| |||||||||||||||||||| |||||||||||||||||||||||||||
10125R-2.in silico     181 ACGCCT-TTTGTTGGATCTACGGGGCCTATGTGAGCGACAATGTGACTGTGACGCCCCTA 240


10125R-2.IR_full       241 AGGAATGGAGCTGCACAGTGCCGACCAGATGCGGTTAGTAAGGTAGTGCCCCCGGAAAAT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10125R-2.in silico     241 AGGAATGGAGCTGCACAGTGCCGACCAGATGCGGTTAGTAAGGTAGTGCCCCCGGAAAAT 300


10125R-2.IR_full       301 CGTAACTACATAACCTACTATCAGTGGGTCGTGCTGGTATTGCTGCTCGAGTCGTTTGTG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10125R-2.in silico     301 CGTAACTACATAACCTACTATCAGTGGGTCGTGCTGGTATTGCTGCTCGAGTCGTTTGTG 360


10125R-2.IR_full       361 TTTTATATGCCAGCATTTCTCTGGAAGATTTGGGAGGGCGGTCGGCTGAAGCATTTGTGC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10125R-2.in silico     361 TTTTATATGCCAGCATTTCTCTGGAAGATTTGGGAGGGCGGTCGGCTGAAGCATTTGTGC 420


10125R-2.IR_full       421 GATGATTTCCACAAGATGGCCGTTTGCAAGGACAAGAGCAGGACCCATTTGCGCGTACTA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10125R-2.in silico     421 GATGATTTCCACAAGATGGCCGTTTGCAAGGACAAGAGCAGGACCCATTTGCGCGTACTA 480


10125R-2.IR_full       481 GTCAACTACTTCTCCAGCGAT 501
                           |||||||||||||||||||||
10125R-2.in silico     481 GTCAACTACTTCTCCAGCGAT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139792.2  CG10125-RA (zpg), mRNA 
0   13  22  NM_133125.2  CG7537-RB (inx5), mRNA 
0   38  NM_132146.1  CG17063-RA (inx6), mRNA 
0   NM_176699.1  CG2977-RA, transcript variant A (inx7), mRNA 
0   NM_176698.1  CG2977-RB, transcript variant B (inx7), mRNA 
0   NM_176447.1  CG33208-RF, transcript variant F (MICAL), mRNA 
0   NM_176445.1  CG33208-RC, transcript variant C (MICAL), mRNA 
0   NM_176449.1  CG33208-RH, transcript variant H (MICAL), mRNA 
0   NM_176448.1  CG33208-RG, transcript variant G (MICAL), mRNA 
0   NM_176446.1  CG33208-RD, transcript variant D (MICAL), mRNA 
0   NM_176444.1  CG33208-RB, transcript variant B (MICAL), mRNA 
0   NM_176443.1  CG33208-RE, transcript variant E (MICAL), mRNA 
0   NM_136033.2  CG12750-RA (ncm), mRNA 
0   NM_001043277.1  CG31163-RD, transcript variant D (CG31163), mRNA 
0   NM_141017.2  CG12983-RA (CG12983), mRNA 
0   NM_130517.2  CG3026-RA (mus81), mRNA 
0   NM_135666.1  CG6589-RA (CG6589), mRNA 
0   NM_170035.1  CG4917-RB, transcript variant B (wfs1), mRNA 
0   NM_142822.1  CG4917-RA, transcript variant A (wfs1), mRNA 
0   NM_165051.2  CG7311-RB, transcript variant B (CG7311), mRNA 
0   NM_135823.2  CG7311-RA, transcript variant A (CG7311), mRNA 
0   NM_134864.3  CG2848-RA (Trn-SR), mRNA 
0   NM_167231.3  CG17255-RB, transcript variant B (CG17255), mRNA 
0   NM_132403.3  CG17255-RA, transcript variant A (CG17255), mRNA 
0   NM_142719.1  CG15497-RA (CG15497), mRNA 
0   NM_132544.1  CG18130-RA (CG18130), mRNA 
0   NM_168670.1  CG32158-RB, transcript variant B (CG32158), mRNA 
0   NM_135497.1  CG4804-RA (CG4804), mRNA 
0   NM_137251.2  CG8443-RA (CG8443), mRNA 
0   NM_135605.2  CG6729-RA (CG6729), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.