National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10125R-1 
 Symbol zpg  Full Name zero population growth 
 CG No CG10125  Old CG No CG10125 
 Synonyms inx-4, inx4, CG10125, Dm-inx4, zpg 
 Accession No (Link to NCBI) NM_139792.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CTGTTAAACCGCTCTCCAAGTATCTGCAGTTCAAGTCGGTGCACATCTACGATGCTATTT 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TCACGCTGCACTCCAAAGTCACAGTGGCCCTGCTTTTGGCCTGCACATTTTTGCTTTCCT 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CGAAACAATATTTCGGCGATCCCATCCAGTGTTTTGGGGACAAGGATATGGACTACGTGC 180

                           |||||| |||| |||||||||||||||||||| ||||||||||||||||||||||||||| silico     181 ACGCCT-TTTGTTGGATCTACGGGGCCTATGTGAGCGACAATGTGACTGTGACGCCCCTA 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AGGAATGGAGCTGCACAGTGCCGACCAGATGCGGTTAGTAAGGTAGTGCCCCCGGAAAAT 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CGTAACTACATAACCTACTATCAGTGGGTCGTGCTGGTATTGCTGCTCGAGTCGTTTGTG 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TTTTATATGCCAGCATTTCTCTGGAAGATTTGGGAGGGCGGTCGGCTGAAGCATTTGTGC 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GATGATTTCCACAAGATGGCCGTTTGCAAGGACAAGAGCAGGACCCATTTGCGCGTACTA 480

10125R-1.IR_full       481 GTCAACTACTTCTCCAGCGAT 501
                           ||||||||||||||||||||| silico     481 GTCAACTACTTCTCCAGCGAT 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139792.2  CG10125-RA (zpg), mRNA 
0   13  22  NM_133125.2  CG7537-RB (inx5), mRNA 
0   38  NM_132146.1  CG17063-RA (inx6), mRNA 
0   NM_176699.1  CG2977-RA, transcript variant A (inx7), mRNA 
0   NM_176698.1  CG2977-RB, transcript variant B (inx7), mRNA 
0   NM_176447.1  CG33208-RF, transcript variant F (MICAL), mRNA 
0   NM_176445.1  CG33208-RC, transcript variant C (MICAL), mRNA 
0   NM_176449.1  CG33208-RH, transcript variant H (MICAL), mRNA 
0   NM_176448.1  CG33208-RG, transcript variant G (MICAL), mRNA 
0   NM_176446.1  CG33208-RD, transcript variant D (MICAL), mRNA 
0   NM_176444.1  CG33208-RB, transcript variant B (MICAL), mRNA 
0   NM_176443.1  CG33208-RE, transcript variant E (MICAL), mRNA 
0   NM_136033.2  CG12750-RA (ncm), mRNA 
0   NM_001043277.1  CG31163-RD, transcript variant D (CG31163), mRNA 
0   NM_141017.2  CG12983-RA (CG12983), mRNA 
0   NM_130517.2  CG3026-RA (mus81), mRNA 
0   NM_135666.1  CG6589-RA (CG6589), mRNA 
0   NM_170035.1  CG4917-RB, transcript variant B (wfs1), mRNA 
0   NM_142822.1  CG4917-RA, transcript variant A (wfs1), mRNA 
0   NM_165051.2  CG7311-RB, transcript variant B (CG7311), mRNA 
0   NM_135823.2  CG7311-RA, transcript variant A (CG7311), mRNA 
0   NM_134864.3  CG2848-RA (Trn-SR), mRNA 
0   NM_167231.3  CG17255-RB, transcript variant B (CG17255), mRNA 
0   NM_132403.3  CG17255-RA, transcript variant A (CG17255), mRNA 
0   NM_142719.1  CG15497-RA (CG15497), mRNA 
0   NM_132544.1  CG18130-RA (CG18130), mRNA 
0   NM_168670.1  CG32158-RB, transcript variant B (CG32158), mRNA 
0   NM_135497.1  CG4804-RA (CG4804), mRNA 
0   NM_137251.2  CG8443-RA (CG8443), mRNA 
0   NM_135605.2  CG6729-RA (CG6729), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.