National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10122R-1 
 Symbol RpI1  Full Name RNA polymerase I subunit 
 CG No CG10122  Old CG No CG10122 
 Synonyms 153129_at, RPA1, DmRPA1, CG10122, RpI1 
 Accession No (Link to NCBI) NM_079019.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Ohhara Y, Nakamura A, Kato Y, Yamakawa-Kobayashi K.
Chaperonin TRiC/CCT supports mitotic exit and entry into endocycle in Drosophila.
PLoS Genet (2019) 15(4) e1008121 [ PubMed ID = 31034473 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAGCGACTTCTCTGCATATTC 
 Primer Seq. 3'
aatctagaggtaccGCGTATATCTGGCGCAGATAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CAGCGACTTC TCTGCATATT CTGTTTGCAC TGCTACAAGC TGCAGATGAA GGATCACGAA 
0061 TGTGAGATAA TTATGTTNAC AGCTGCGCCT AATCGACGCT GGGTACATCA TCGAGGCGCA 
0121 GGAGTTGGAA CTCTTCAAGT CAGAAATTGT GTGCCAAAAC ACCGAAAATC TGGTAGCCAT 
0181 CAAAAACGGC GATATGGTGC ACCCACACAT TGCTGCCATG TATAAACTGC TGGAAAAAAA 
0241 TGAGAAGAAC TCCAGCAACT CCACTAAGAC GAGCTGTTCC CTGCGCACAG CCATTACGCA 
0301 TTCGGCACTG CAGCGACTGG GCAAGAAGTG CAGGCACTGT AACAAGTCTA TGCGTTTCGT 
0361 GCGTTATATG CATCGTAGGC TGGTATTCTA CGTGACTTTG GCAGATATTA AAGAACGCGT 
0421 TGGCACGGGC GCAGAAACCG GTGGTCAGAA TAAAGTGATC TTCGCAGACG AATGTCGTCG 
0481 TTATCTGCGC CAGATANANG C 
 in silico PCR Fragment
0001 CAGCGACTTC TCTGCATATT CTGTTTGCAC TGCTACAAGC TGCAGATGAA GGATCACGAA 
0061 TGTGAGATAA TTATGTT-AC AGCTGCGCCT AATCGACGCT GGGTACATCA TCGAGGCGCA 
0121 GGAGTTGGAA CTCTTCAAGT CAGAAATTGT GTGCCAAAAC ACCGAAAATC TGGTAGCCAT 
0181 CAAAAACGGC GATATGGTGC ACCCACACAT TGCTGCCATG TATAAACTGC TGGAAAAAAA 
0241 TGAGAAGAAC TCCAGCAACT CCACTAAGAC GAGCTGTTCC CTGCGCACAG CCATTACGCA 
0301 TTCGGCACTG CAGCGACTGG GCAAGAAGTG CAGGCACTGT AACAAGTCTA TGCGTTTCGT 
0361 GCGTTATATG CATCGTAGGC TGGTATTCTA CGTGACTTTG GCAGATATTA AAGAACGCGT 
0421 TGGCACGGGC GCAGAAACCG GTGGTCAGAA TAAAGTGATC TTCGCAGACG AATGTCGTCG 
0481 TTATCTGCGC CAGATATACG C 
 Assemble Data

10122R-1.IR_full       1   CAGCGACTTCTCTGCATATTCTGTTTGCACTGCTACAAGCTGCAGATGAAGGATCACGAA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10122R-1.in silico     1   CAGCGACTTCTCTGCATATTCTGTTTGCACTGCTACAAGCTGCAGATGAAGGATCACGAA 60


10122R-1.IR_full       61  TGTGAGATAATTATGTTNACAGCTGCGCCTAATCGACGCTGGGTACATCATCGAGGCGCA 120
                           ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
10122R-1.in silico     61  TGTGAGATAATTATGTT-ACAGCTGCGCCTAATCGACGCTGGGTACATCATCGAGGCGCA 120


10122R-1.IR_full       121 GGAGTTGGAACTCTTCAAGTCAGAAATTGTGTGCCAAAACACCGAAAATCTGGTAGCCAT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10122R-1.in silico     121 GGAGTTGGAACTCTTCAAGTCAGAAATTGTGTGCCAAAACACCGAAAATCTGGTAGCCAT 180


10122R-1.IR_full       181 CAAAAACGGCGATATGGTGCACCCACACATTGCTGCCATGTATAAACTGCTGGAAAAAAA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10122R-1.in silico     181 CAAAAACGGCGATATGGTGCACCCACACATTGCTGCCATGTATAAACTGCTGGAAAAAAA 240


10122R-1.IR_full       241 TGAGAAGAACTCCAGCAACTCCACTAAGACGAGCTGTTCCCTGCGCACAGCCATTACGCA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10122R-1.in silico     241 TGAGAAGAACTCCAGCAACTCCACTAAGACGAGCTGTTCCCTGCGCACAGCCATTACGCA 300


10122R-1.IR_full       301 TTCGGCACTGCAGCGACTGGGCAAGAAGTGCAGGCACTGTAACAAGTCTATGCGTTTCGT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10122R-1.in silico     301 TTCGGCACTGCAGCGACTGGGCAAGAAGTGCAGGCACTGTAACAAGTCTATGCGTTTCGT 360


10122R-1.IR_full       361 GCGTTATATGCATCGTAGGCTGGTATTCTACGTGACTTTGGCAGATATTAAAGAACGCGT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10122R-1.in silico     361 GCGTTATATGCATCGTAGGCTGGTATTCTACGTGACTTTGGCAGATATTAAAGAACGCGT 420


10122R-1.IR_full       421 TGGCACGGGCGCAGAAACCGGTGGTCAGAATAAAGTGATCTTCGCAGACGAATGTCGTCG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10122R-1.in silico     421 TGGCACGGGCGCAGAAACCGGTGGTCAGAATAAAGTGATCTTCGCAGACGAATGTCGTCG 480


10122R-1.IR_full       481 TTATCTGCGCCAGATANANGC 501
                           |||||||||||||||| | ||
10122R-1.in silico     481 TTATCTGCGCCAGATATACGC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079019.2  CG10122-RA (RpI1), mRNA 
0   NM_167389.1  CG32613-RA (CG32613), mRNA 
0   NM_165906.1  CG12369-RB, transcript variant B (Lac), mRNA 
0   NM_078989.2  CG12369-RA, transcript variant A (Lac), mRNA 
0   NM_136502.2  CG14762-RA (CG14762), mRNA 
0   NM_170249.1  CG31089-RA (CG31089), mRNA 
0   NM_132660.2  CG1716-RA (CG1716), mRNA 
0   NM_080488.2  CG6349-RA (DNApol-alpha180), mRNA 
0   NM_144077.2  CG18675-RA (CG18675), mRNA 
0   NM_079196.2  CG1232-RA, transcript variant A (tipE), mRNA 
0   NM_168067.1  CG1232-RB, transcript variant B (tipE), mRNA 
0   NM_136941.2  CG8828-RA (CG8828), mRNA 
0   NM_206599.1  CG4122-RD, transcript variant D (svr), mRNA 
0   NM_166846.3  CG4122-RA, transcript variant A (svr), mRNA 
0   NM_080293.3  CG4122-RB, transcript variant B (svr), mRNA 
0   NM_206596.1  CG4122-RG, transcript variant G (svr), mRNA 
0   NM_176679.2  CG4122-RC, transcript variant C (svr), mRNA 
0   NM_140521.1  CG6498-RA (CG6498), mRNA 
0   NM_079738.2  CG6768-RA (DNApol-epsilon), mRNA 
0   NM_169489.1  CG7518-RA, transcript variant A (CG7518), mRNA 
0   NM_141993.2  CG7518-RB, transcript variant B (CG7518), mRNA 
0   NM_141964.2  CG6225-RA (CG6225), mRNA 
0   NM_140876.1  CG8798-RA, transcript variant A (CG8798), mRNA 
0   NM_168806.1  CG8798-RB, transcript variant B (CG8798), mRNA 
0   NM_078545.2  CG12653-RA (btd), mRNA 
0   NM_143055.2  CG11120-RA, transcript variant A (CG11120), mRNA 
0   NM_170183.2  CG11120-RB, transcript variant B (CG11120), mRNA 
0   NM_176538.2  CG33093-RA (CG33093), mRNA 
0   NM_143348.2  CG4849-RA (CG4849), mRNA 
0   NM_001043254.1  CG14885-RB, transcript variant B (Gyc-89Da), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.