National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10117R-1 
 Symbol ttv  Full Name tout-velu 
 CG No CG10117  Old CG No CG10117 
 Synonyms CG10117, DEXT1, l(2)05282, l(2)00681, P1.15, l(2)k03617, l(2)k00115, ttv, Ext1, Ttv 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Ueyama M, Takemae H, Ohmae Y, Yoshida H, Toyoda H, Ueda R, Nishihara S.
Functional analysis of proteoglycan galactosyltransferase II RNA interference mutant flies.
J. Biol. Chem. (2008) 283(10) 6076-84 [ PubMed ID = 18165227 ] [ RRC reference ]

Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TGGCCTACGCCTATTTCGGTGGCTATCGCCTGAAAGTCTCACCATTGAGACCCCGTAGAG 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CCCAGCACGAATCGGCCAAGGATGGTGGAGTTCAACCCCACGAGCAGTTGCCCAGCTTCC 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TGGGCGCCCACGATATGCAGGAACTCCAACTGCTGCAGAGCAATCAATCGAAGAGTTTGG 180

                           ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| silico     181 ATAGCTCCAAGCACCTGGTTACCCGCAAACCCGACTGCCGCATGGAGACCTGTTTCGATT 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TTACCCGCTGTTATGATCGCTTTTTGGTCTATATCTATCCACCGGAACCACTTAACTCAC 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TGGGCGCTGCCCCGCCCACCTCGGCCAACTATCAAAAGATACTCACTGCCATCCAGGAAT 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CGAGATATTATACCAGTGATCCCACGGCCGCCTGTCTCTTTGTGCTCGGTATCGATACCC 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TGGATCGAGATTCCCTATCCGAGGATTATGTTCGGAATGTGCCATCCAGATTGGCAAGAT 480

                           |||||||||||||||||||||||||||||||||||||| silico     481 TGCCGTATTGGAACAATGGCAGGAACCACATTATCTTC 518

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  500  NM_057883.2  tout-velu CG10117-RA (ttv), mRNA 
NM_136632.2  CG1968-RB, transcript variant B (CG1968), mRNA 
NM_165673.1  CG1968-RA, transcript variant A (CG1968), mRNA 
NM_001032104.1  CG33911-RA (CG33911), mRNA 
NM_078600.2  Netrin-B CG10521-RA (NetB), mRNA 
NM_078639.2  katanin 80 CG13956-RB, transcript variant B (kat80), mRNA 
NM_167488.1  katanin 80 CG13956-RA, transcript variant A (kat80), mRNA 
NM_142815.2  mitochondrial ribosomal protein L45 CG6949-RA (mRpL45), mRNA 
NM_135299.2  CG7203-RA (CG7203), mRNA 
NM_135716.2  CG17010-RA, transcript variant A (CG17010), mRNA 
NM_078722.2  dachsous CG17941-RA (ds), mRNA 
NM_165008.1  CG17010-RB, transcript variant B (CG17010), mRNA 
NM_140879.1  CG9392-RA (CG9392), mRNA 
NM_169059.1  NMDA receptor 1 CG2902-RA (Nmdar1), mRNA 
NM_139760.1  CG10472-RA (CG10472), mRNA 
NM_141953.1  CG18554-RA (CG18554), mRNA 
NM_142241.1  Arpc3A CG4560-RB, transcript variant B (Arpc3A), mRNA 
15  NM_132335.2  CG12139-RB (CG12139), mRNA 
NM_130546.2  CG11409-RB (CG11409), mRNA 
NM_079649.2  moira CG18740-RA (mor), mRNA 
11  NM_166186.2  gprs CG18471-RA (gprs), mRNA 
NM_170038.1  winged eye CG31151-RB, transcript variant B (wge), mRNA 
NM_001043281.1  winged eye CG31151-RC, transcript variant C (wge), mRNA 
NM_170037.1  winged eye CG31151-RA, transcript variant A (wge), mRNA 
NM_057614.2  Ror CG4926-RA (Ror), mRNA 
NM_137896.2  CG9849-RA (CG9849), mRNA 
NM_080014.2  futsch CG3064-RB (futsch), mRNA 
NM_140638.2  Tyrosyl-tRNA synthetase CG4561-RA (Aats-tyr), mRNA 
NM_169676.1  CG31150-RA (CG31150), mRNA 
10  NM_137054.1  CG6280-RA (CG6280), mRNA 
100  482  NM_057883.2  tout-velu CG10117-RA (ttv), mRNA 
NM_137012.1  CG4712-RB, transcript variant B (CG4712), mRNA 
NM_165975.1  CG4712-RA, transcript variant A (CG4712), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.