National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1009R-3 
 Symbol Psa  Full Name Puromycin sensitive aminopeptidase 
 CG No CG1009  Old CG No CG1009 
 Synonyms dPsa, CG1009, Psa 
 Accession No (Link to NCBI) NM_167885.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Kruppa AJ, Ott S, Chandraratna DS, Irving JA, Page RM, Speretta E, Seto T, Camargo LM, Marciniak SJ, Lomas DA, Crowther DC.
Suppression of Aβ toxicity by puromycin-sensitive aminopeptidase is independent of its proteolytic activity.
Biochim. Biophys. Acta (2013) 1832(12) 2115-26 [ PubMed ID = 23911349 ] [ RRC reference ]

Molnar C, Casado M, López-Varea A, Cruz C, de Celis JF.
Genetic annotation of gain-of-function screens using RNA interference and in situ hybridization of candidate genes in the Drosophila wing.
Genetics (2012) 192(2) 741-52 [ PubMed ID = 22798488 ] [ RRC reference ]

Menzies FM, Hourez R, Imarisio S, Raspe M, Sadiq O, Chandraratna D, O'Kane C, Rock KL, Reits E, Goldberg AL, Rubinsztein DC.
Puromycin-sensitive aminopeptidase protects against aggregation-prone proteins via autophagy.
Hum. Mol. Genet. (2010) 19(23) 4573-86 [ PubMed ID = 20829225 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGAGCCCGCCATTAAAGCCAC 
 Primer Seq. 3'
aatctagaggtaccTGCCGAACCACTGATGGGCAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGAGCCCGCC ATTAAAGCCA CCTTCGACAT CACACTGGTG GTGCCCAAGG ACCGGGTGGC 
0061 TCTGTCCAAC ATGCCGGTCA TCAAGGAGGA TTCCCTTCCA GACGGTCTGC GACGAGTGCG 
0121 TTTCGACCGC ACGCCCATCA TGTCCACCTA CCTGGTGGCC GTCGTAGTGG GCGAGTACGA 
0181 CTATGTCGAG GGCAAGTCCG ACGATGGCGT CCTCGTCAGG GTTTTCACAC CCGTTGGCAA 
0241 ACGCGANGCA GGGCACCTTC GCCCTGGAGG TGGCCACCAA GGTGCTGCCG TACTACAAGG 
0301 ACTACTTCAA CATCGCCTAT CCGTTGCCCA AGATGGACCT GATCGCCATC TCCGACTTCT 
0361 CGGCCGGCGC CATGGAGAAC TGGGGCCTGG TCACCTACCG TGAGACCTTC GTGCTAGTGG 
0421 ACCCGAAGAA CACCTCGCTG ATGCGCAAGC AGTCGATTGC GCTGACAGTG GGTCACGAGA 
0481 TTGCCCATCA GTGGTTCGGC A 
 in silico PCR Fragment
0001 CGAGCCCGCC ATTAAAGCCA CCTTCGACAT CACACTGGTG GTGCCCAAGG ACCGGGTGGC 
0061 TCTGTCCAAC ATGCCGGTCA TCAAGGAGGA TTCCCTTCCA GACGGTCTGC GACGAGTGCG 
0121 TTTCGACCGC ACGCCCATCA TGTCCACCTA CCTGGTGGCC GTCGTAGTGG GCGAGTACGA 
0181 CTATGTCGAG GGCAAGTCCG ACGATGGCGT CCTCGTCAGG GTTTTCACAC CCGTTGGCAA 
0241 ACGCGA-GCA GGGCACTTTC GCCCTGGAGG TGGCCACCAA GGTGCTGCCG TACTACAAGG 
0301 ACTACTTCAA CATCGCGTAT CCGTTACCCA AGATGGACCT CATCGCCATC TCCGACTTCT 
0361 CGGCCGGCGC CATGGAGAAC TGGGGCCTGG TCACCTACCG TGAGACCTTT GTGCTAGTGG 
0421 ACCCGAAGAA CACCTCGCTG ATGCGCAAGC AGTCGATTGC GCTGACAGTG GGTCACGAGA 
0481 TTGCCCATCA GTGGTTCGGC A 
 Assemble Data

1009R-3.IR_full       1   CGAGCCCGCCATTAAAGCCACCTTCGACATCACACTGGTGGTGCCCAAGGACCGGGTGGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1009R-3.in silico     1   CGAGCCCGCCATTAAAGCCACCTTCGACATCACACTGGTGGTGCCCAAGGACCGGGTGGC 60


1009R-3.IR_full       61  TCTGTCCAACATGCCGGTCATCAAGGAGGATTCCCTTCCAGACGGTCTGCGACGAGTGCG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1009R-3.in silico     61  TCTGTCCAACATGCCGGTCATCAAGGAGGATTCCCTTCCAGACGGTCTGCGACGAGTGCG 120


1009R-3.IR_full       121 TTTCGACCGCACGCCCATCATGTCCACCTACCTGGTGGCCGTCGTAGTGGGCGAGTACGA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1009R-3.in silico     121 TTTCGACCGCACGCCCATCATGTCCACCTACCTGGTGGCCGTCGTAGTGGGCGAGTACGA 180


1009R-3.IR_full       181 CTATGTCGAGGGCAAGTCCGACGATGGCGTCCTCGTCAGGGTTTTCACACCCGTTGGCAA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1009R-3.in silico     181 CTATGTCGAGGGCAAGTCCGACGATGGCGTCCTCGTCAGGGTTTTCACACCCGTTGGCAA 240


1009R-3.IR_full       241 ACGCGANGCAGGGCACCTTCGCCCTGGAGGTGGCCACCAAGGTGCTGCCGTACTACAAGG 300
                          |||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||
1009R-3.in silico     241 ACGCGA-GCAGGGCACTTTCGCCCTGGAGGTGGCCACCAAGGTGCTGCCGTACTACAAGG 300


1009R-3.IR_full       301 ACTACTTCAACATCGCCTATCCGTTGCCCAAGATGGACCTGATCGCCATCTCCGACTTCT 360
                          |||||||||||||||| |||||||| |||||||||||||| |||||||||||||||||||
1009R-3.in silico     301 ACTACTTCAACATCGCGTATCCGTTACCCAAGATGGACCTCATCGCCATCTCCGACTTCT 360


1009R-3.IR_full       361 CGGCCGGCGCCATGGAGAACTGGGGCCTGGTCACCTACCGTGAGACCTTCGTGCTAGTGG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
1009R-3.in silico     361 CGGCCGGCGCCATGGAGAACTGGGGCCTGGTCACCTACCGTGAGACCTTTGTGCTAGTGG 420


1009R-3.IR_full       421 ACCCGAAGAACACCTCGCTGATGCGCAAGCAGTCGATTGCGCTGACAGTGGGTCACGAGA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1009R-3.in silico     421 ACCCGAAGAACACCTCGCTGATGCGCAAGCAGTCGATTGCGCTGACAGTGGGTCACGAGA 480


1009R-3.IR_full       481 TTGCCCATCAGTGGTTCGGCA 501
                          |||||||||||||||||||||
1009R-3.in silico     481 TTGCCCATCAGTGGTTCGGCA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_167886.1  CG1009-RD, transcript variant D (Psa), mRNA 
100   482  NM_139360.2  CG1009-RB, transcript variant B (Psa), mRNA 
100   482  NM_167885.1  CG1009-RA, transcript variant A (Psa), mRNA 
100   482  NM_167887.1  CG1009-RF, transcript variant F (Psa), mRNA 
100   482  NM_167883.1  CG1009-RC, transcript variant C (Psa), mRNA 
100   482  NM_167884.1  CG1009-RE, transcript variant E (Psa), mRNA 
1.03   12  10  11  NM_170405.1  CG11956-RB, transcript variant B (SP1029), mRNA 
1.03   12  10  11  NM_144361.1  CG11956-RA, transcript variant A (SP1029), mRNA 
1.03   12  10  11  NM_170406.1  CG11956-RC, transcript variant C (SP1029), mRNA 
0.62   13  21  19  NM_169964.1  CG31343-RA (CG31343), mRNA 
0.2   12  23  NM_144487.1  CG5518-RA (sda), mRNA 
0.2   11  NM_078564.2  CG1594-RA (hop), mRNA 
0   15  NM_137937.2  CG3502-RA (CG3502), mRNA 
0   11  14  NM_143432.2  CG31445-RA (CG31445), mRNA 
0   12  NM_169965.1  CG31233-RA (CG31233), mRNA 
0   13  NM_143431.1  CG11951-RA (CG11951), mRNA 
0   12  19  NM_143417.2  CG14516-RB, transcript variant B (CG14516), mRNA 
0   12  19  NM_170398.1  CG14516-RA, transcript variant A (CG14516), mRNA 
0   NM_135706.2  CG16996-RA (CG16996), mRNA 
0   NM_132416.1  CG2111-RA (CG2111), mRNA 
0   NM_058112.3  CG13388-RA, transcript variant A (Akap200), mRNA 
0   NM_175984.1  CG13388-RD, transcript variant D (Akap200), mRNA 
0   NM_164820.1  CG13388-RC, transcript variant C (Akap200), mRNA 
0   NM_058111.3  CG13388-RB, transcript variant B (Akap200), mRNA 
0   25  NM_142016.1  CG8773-RA (CG8773), mRNA 
0   17  NM_142722.1  CG5849-RA (CG5849), mRNA 
0   NM_137809.1  CG3292-RA (CG3292), mRNA 
0   NM_134681.2  CG4164-RA (CG4164), mRNA 
0   NM_137912.1  CG9876-RA (CG9876), mRNA 
0   NM_167940.1  CG32305-RA (CG32305), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.