National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1009R-3 
 Symbol Psa  Full Name Puromycin sensitive aminopeptidase 
 CG No CG1009  Old CG No CG1009 
 Synonyms dPsa, CG1009, Psa 
 Accession No (Link to NCBI) NM_167885.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal semi-lethal 
 Map Viewer
[Please submit your publication]
Menzies FM, Hourez R, Imarisio S, Raspe M, Sadiq O, Chandraratna D, O'Kane C, Rock KL, Reits E, Goldberg AL, Rubinsztein DC.
Puromycin-sensitive aminopeptidase protects against aggregation-prone proteins via autophagy.
Hum. Mol. Genet. (2010) 19(23) 4573-86 [ PubMed ID = 20829225 ] [ RRC reference ]

Kruppa AJ, Ott S, Chandraratna DS, Irving JA, Page RM, Speretta E, Seto T, Camargo LM, Marciniak SJ, Lomas DA, Crowther DC.
Suppression of Aβ toxicity by puromycin-sensitive aminopeptidase is independent of its proteolytic activity.
Biochim. Biophys. Acta (2013) 1832(12) 2115-26 [ PubMed ID = 23911349 ] [ RRC reference ]

Molnar C, Casado M, López-Varea A, Cruz C, de Celis JF.
Genetic annotation of gain-of-function screens using RNA interference and in situ hybridization of candidate genes in the Drosophila wing.
Genetics (2012) 192(2) 741-52 [ PubMed ID = 22798488 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CGAGCCCGCCATTAAAGCCACCTTCGACATCACACTGGTGGTGCCCAAGGACCGGGTGGC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TCTGTCCAACATGCCGGTCATCAAGGAGGATTCCCTTCCAGACGGTCTGCGACGAGTGCG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TTTCGACCGCACGCCCATCATGTCCACCTACCTGGTGGCCGTCGTAGTGGGCGAGTACGA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CTATGTCGAGGGCAAGTCCGACGATGGCGTCCTCGTCAGGGTTTTCACACCCGTTGGCAA 240

                          |||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||| silico     241 ACGCGA-GCAGGGCACTTTCGCCCTGGAGGTGGCCACCAAGGTGCTGCCGTACTACAAGG 300

                          |||||||||||||||| |||||||| |||||||||||||| ||||||||||||||||||| silico     301 ACTACTTCAACATCGCGTATCCGTTACCCAAGATGGACCTCATCGCCATCTCCGACTTCT 360

                          ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| silico     361 CGGCCGGCGCCATGGAGAACTGGGGCCTGGTCACCTACCGTGAGACCTTTGTGCTAGTGG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ACCCGAAGAACACCTCGCTGATGCGCAAGCAGTCGATTGCGCTGACAGTGGGTCACGAGA 480

1009R-3.IR_full       481 TTGCCCATCAGTGGTTCGGCA 501
                          ||||||||||||||||||||| silico     481 TTGCCCATCAGTGGTTCGGCA 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_167886.1  CG1009-RD, transcript variant D (Psa), mRNA 
100   482  NM_139360.2  CG1009-RB, transcript variant B (Psa), mRNA 
100   482  NM_167885.1  CG1009-RA, transcript variant A (Psa), mRNA 
100   482  NM_167887.1  CG1009-RF, transcript variant F (Psa), mRNA 
100   482  NM_167883.1  CG1009-RC, transcript variant C (Psa), mRNA 
100   482  NM_167884.1  CG1009-RE, transcript variant E (Psa), mRNA 
1.03   12  10  11  NM_170405.1  CG11956-RB, transcript variant B (SP1029), mRNA 
1.03   12  10  11  NM_144361.1  CG11956-RA, transcript variant A (SP1029), mRNA 
1.03   12  10  11  NM_170406.1  CG11956-RC, transcript variant C (SP1029), mRNA 
0.62   13  21  19  NM_169964.1  CG31343-RA (CG31343), mRNA 
0.2   12  23  NM_144487.1  CG5518-RA (sda), mRNA 
0.2   11  NM_078564.2  CG1594-RA (hop), mRNA 
0   15  NM_137937.2  CG3502-RA (CG3502), mRNA 
0   11  14  NM_143432.2  CG31445-RA (CG31445), mRNA 
0   12  NM_169965.1  CG31233-RA (CG31233), mRNA 
0   13  NM_143431.1  CG11951-RA (CG11951), mRNA 
0   12  19  NM_143417.2  CG14516-RB, transcript variant B (CG14516), mRNA 
0   12  19  NM_170398.1  CG14516-RA, transcript variant A (CG14516), mRNA 
0   NM_135706.2  CG16996-RA (CG16996), mRNA 
0   NM_132416.1  CG2111-RA (CG2111), mRNA 
0   NM_058112.3  CG13388-RA, transcript variant A (Akap200), mRNA 
0   NM_175984.1  CG13388-RD, transcript variant D (Akap200), mRNA 
0   NM_164820.1  CG13388-RC, transcript variant C (Akap200), mRNA 
0   NM_058111.3  CG13388-RB, transcript variant B (Akap200), mRNA 
0   25  NM_142016.1  CG8773-RA (CG8773), mRNA 
0   17  NM_142722.1  CG5849-RA (CG5849), mRNA 
0   NM_137809.1  CG3292-RA (CG3292), mRNA 
0   NM_134681.2  CG4164-RA (CG4164), mRNA 
0   NM_137912.1  CG9876-RA (CG9876), mRNA 
0   NM_167940.1  CG32305-RA (CG32305), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.