National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1007R-1 
 Symbol emc  Full Name extra macrochaetae 
 CG No CG1007  Old CG No CG1007 
 Synonyms Emc, CG1007, l(3)05592, Dm0688, 0977/09, 0587/01, 0203/10, 0094/26, gov, ms(3)61CD, Ach, l(3)j4E11, l(3)04322, emc 
 Accession No (Link to NCBI) NM_079152.3 
 Inserted Chr. lll 
 Insertional Mutation  2 lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Bauke AC, Sasse S, Matzat T, Klämbt C.
A transcriptional network controlling glial development in the Drosophila visual system.
Development (2015) 142(12) 2184-93 [ PubMed ID = 26015542 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACGGGGAGAACGCCGAGATGA 
 Primer Seq. 3'
aatctagaggtaccCTGTCTGCTGTCTTTCTCCGC 
 Predicted Fragment Size
497 
 IR fragment full Seq
0001 ACGGGGAGAA CGCCGAGATG AAGATGTATC TGTCCAAACT GNAAGGACCT CGTTCCGTTC 
0061 ATGCCCAAGA ACAGGAAGCT CACCAAGCTG GAGATCATCC AGCACGTCAT CGACTACATC 
0121 TGCGACCTGC AGACCGAGCT GGAGACGCAC CCCGAGATGG GCAACTTCGA TTGCGGCANG 
0181 CGCTCTGACG GCGGTGAACG GACTCCACGA GGACGAGGAC AGCGACATGG AGGATGCGGA 
0241 TGNCGAGGCA GAAGCGGNAA GTCGATCCAG ATATCCTCGC CCAGCGCCTG AATGCCGAGC 
0301 AGCCGGCGAN AAGTCNTCTA GTCCCGCCGC CCGTCTCCCG CTTACCGATC GCCAAACGCC 
0361 CAACACTCTT GTGGCGCCCG CCCATCCGCA GCAGCATCAG CAGCAGCAGC AACTGCAACT 
0421 GCAGCAGCAA CAACTGCAAT CACAGCAGCA ACTGTCCAAC AGTTTAGcAA CGCCACAGAA 
0481 TGCGGAGAAA GACAGCAGAC AG 
 in silico PCR Fragment
0001 ACGGGGAGAA CGCCGAGATG AAGATGTATC TGTCCAAACT G-AAGGACCT CGTTCCGTTC 
0061 ATGCCCAAGA ACAGGAAGCT CACCAAGCTG GAGATCATCC AGCACGTCAT CGACTACATC 
0121 TGCGACCTGC AGACCGAGCT GGAGACGCAC CCCGAGATGG GCAACTTCGA -TGCGGCAGC 
0181 CGCTCTGACG GCGGTGAACG GACTCCACGA GGACGAGGAC AGCGACATGG AGGATGCGGA 
0241 TGCCGAGGCA GAAGCGG-AA GTCGATCCAG ATATCCTCGC CCAGCGCCTG AATGCCGAGC 
0301 AGCCGGCGA- AAGTC-TCTA GTCCCGCCGC CCGTCTCCCG CTTACCGATC GCCAAACGCC 
0361 CAACACTCTT GTGGCGCCCG CCCATCCGCA GCAGCATCAG CAGCAGCAGC AACTGCAACT 
0421 GCAGCAGCAA CAACTGCAAT CACAGCAGCA ACTGTCCAAC AGTTTAGCAA CGCCACAGAA 
0481 TGCGGAGAAA GACAGCAGAC AG 
 Assemble Data

1007R-1.IR_full       1   ACGGGGAGAACGCCGAGATGAAGATGTATCTGTCCAAACTGNAAGGACCTCGTTCCGTTC 60
                          ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
1007R-1.in silico     1   ACGGGGAGAACGCCGAGATGAAGATGTATCTGTCCAAACTG-AAGGACCTCGTTCCGTTC 60


1007R-1.IR_full       61  ATGCCCAAGAACAGGAAGCTCACCAAGCTGGAGATCATCCAGCACGTCATCGACTACATC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1007R-1.in silico     61  ATGCCCAAGAACAGGAAGCTCACCAAGCTGGAGATCATCCAGCACGTCATCGACTACATC 120


1007R-1.IR_full       121 TGCGACCTGCAGACCGAGCTGGAGACGCACCCCGAGATGGGCAACTTCGATTGCGGCANG 180
                          |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||  
1007R-1.in silico     121 TGCGACCTGCAGACCGAGCTGGAGACGCACCCCGAGATGGGCAACTTCGA-TGCGGCAGC 180


1007R-1.IR_full       181 CGCTCTGACGGCGGTGAACGGACTCCACGAGGACGAGGACAGCGACATGGAGGATGCGGA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1007R-1.in silico     181 CGCTCTGACGGCGGTGAACGGACTCCACGAGGACGAGGACAGCGACATGGAGGATGCGGA 240


1007R-1.IR_full       241 TGNCGAGGCAGAAGCGGNAAGTCGATCCAGATATCCTCGCCCAGCGCCTGAATGCCGAGC 300
                          || |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
1007R-1.in silico     241 TGCCGAGGCAGAAGCGG-AAGTCGATCCAGATATCCTCGCCCAGCGCCTGAATGCCGAGC 300


1007R-1.IR_full       301 AGCCGGCGANAAGTCNTCTAGTCCCGCCGCCCGTCTCCCGCTTACCGATCGCCAAACGCC 360
                          ||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||
1007R-1.in silico     301 AGCCGGCGA-AAGTC-TCTAGTCCCGCCGCCCGTCTCCCGCTTACCGATCGCCAAACGCC 360


1007R-1.IR_full       361 CAACACTCTTGTGGCGCCCGCCCATCCGCAGCAGCATCAGCAGCAGCAGCAACTGCAACT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1007R-1.in silico     361 CAACACTCTTGTGGCGCCCGCCCATCCGCAGCAGCATCAGCAGCAGCAGCAACTGCAACT 420


1007R-1.IR_full       421 GCAGCAGCAACAACTGCAATCACAGCAGCAACTGTCCAACAGTTTAGCAACGCCACAGAA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1007R-1.in silico     421 GCAGCAGCAACAACTGCAATCACAGCAGCAACTGTCCAACAGTTTAGCAACGCCACAGAA 480


1007R-1.IR_full       481 TGCGGAGAAAGACAGCAGACAG 502
                          ||||||||||||||||||||||
1007R-1.in silico     481 TGCGGAGAAAGACAGCAGACAG 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   479  16  56  NM_079152.3  CG1007-RA (emc), mRNA 
1.87   55  134  259  NM_132665.1  CG15753-RA (CG15753), mRNA 
1.87   39  209  529  NM_169696.1  CG3992-RA, transcript variant A (srp), mRNA 
1.87   39  209  529  NM_169694.1  CG3992-RB, transcript variant B (srp), mRNA 
1.67   45  135  329  NM_165217.1  CG6667-RA, transcript variant A (dl), mRNA 
1.67   45  135  329  NM_165218.1  CG6667-RB, transcript variant B (dl), mRNA 
1.67   30  135  415  NM_134552.3  CG1412-RA (RhoGAP19D), mRNA 
1.67   29  149  328  NM_141240.1  CG14656-RA (CG14656), mRNA 
1.67   26  139  343  NM_001032019.1  CG3992-RD, transcript variant D (srp), mRNA 
1.67   23  79  219  NM_137046.3  CG6191-RA (CG6191), mRNA 
1.67   16  85  225  NM_001043260.1  CG34157-RD, transcript variant D (Dys), mRNA 
1.67   12  68  164  NM_165017.1  CG12287-RB, transcript variant B (pdm2), mRNA 
1.67   12  61  134  NM_130728.1  CG15240-RA (CG15240), mRNA 
1.67   29  58  NM_137567.1  CG9811-RA (Rgk1), mRNA 
1.46   98  400  1029  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
1.46   98  400  1029  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
1.25   16  67  187  NM_079318.2  CG10488-RA, transcript variant A (eyg), mRNA 
1.25   16  67  187  NM_001014582.1  CG10488-RB, transcript variant B (eyg), mRNA 
1.25   10  57  107  NM_206109.1  CG8118-RC, transcript variant C (mam), mRNA 
1.25   62  166  NM_164960.1  CG32830-RA (CG32830), mRNA 
1.25   21  56  NM_132350.1  CG15321-RA (CG15321), mRNA 
1.25   10  35  NM_136202.4  CG31678-RA (CG31678), mRNA 
1.04   29  104  269  NM_001032408.1  CG33956-RD, transcript variant D (kay), mRNA 
1.04   25  151  353  NM_134527.1  CG15322-RA (CG15322), mRNA 
1.04   12  83  176  NM_136672.2  CG1688-RA (CG1688), mRNA 
1.04   11  97  293  NM_142210.1  CG6118-RA (CG6118), mRNA 
1.04   62  146  NM_206684.2  CG1725-RE, transcript variant E (dlg1), mRNA 
1.04   62  146  NM_206682.2  CG1725-RG, transcript variant G (dlg1), mRNA 
1.04   62  146  NM_078565.3  CG1725-RD, transcript variant D (dlg1), mRNA 
1.04   62  146  NM_167282.2  CG1725-RA, transcript variant A (dlg1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.