National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10079R-2 
 Symbol Egfr  Full Name Epidermal growth factor receptor 
 CG No CG10079  Old CG No CG10079 
 Synonyms egfr, Elp-B1, EGFR, DER, dEGFR, flb, der, d-egf-r, top, torpedo/egfr, EgfR, CG10079, EGF-R, DER/EGFR, Der, D-EGFR, dEGFR1, Egf-r, Elp, l(2)09261, Egf, EK2-6, c-erbB, DER/torpedo, unnamed, DmHD-33, Elp-B1RB1, Elp-1, DER flb, top/DER, Torpedo/Egfr, D-Egf, Degfr, Torpedo/DER, torpedo/Egfr, EGFr, DER/faint little ball, DER/top, l(2)05351, top/flb, l(2)57DEFa, pnt, l(2)57Ea, l(2)57EFa, HD-33, El, C-erb, Egfr, EFG-R 
 Accession No (Link to NCBI) NM_057411.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Swarup S, Pradhan-Sundd T, Verheyen EM.
Genome-wide identification of phospho-regulators of Wnt signaling in Drosophila.
Development (2015) 142(8) 1502-15 [ PubMed ID = 25852200 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Molnar C, de Celis JF.
Tay bridge is a negative regulator of EGFR signalling and interacts with Erk and Mkp3 in the Drosophila melanogaster wing.
PLoS Genet. (2013) 9(12) e1003982 [ PubMed ID = 24348264 ] [ RRC reference ]

Liu M, Lim TM, Cai Y.
The Drosophila female germline stem cell lineage acts to spatially restrict DPP function within the niche.
Sci Signal (2010) 3(132) ra57 [ PubMed ID = 20664066 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGCTCCTGGCCCACTGCATTT 
 Primer Seq. 3'
aatctagaggtaccCGTGCGTCCGCGAATGATTTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGCTCCTGGC CCACTGCATT TGCATTTGGC CCGCGTCGgc GGCCCGCAGA TCGCTACGCC 
0061 CGCCAGAACA ATCGCCAGCG CCATCAGGAT ATAGATCGCG ATCGGGATCG AGATCGATTC 
0121 CTATACCGCA GCAGTTCGGC CCAAAATCGA CAGAGGGGCG GGGCCAACTN TCGCCCTGGG 
0181 ACTGGGAGCC AACGGAGTCA CCATTCCCAC CAGTCTGGAG GATAAGAACA AGAACGAGTT 
0241 CGTCAAGGGG AAAATCTGCA TCGGCACTAA ATCTCGGCTC TCCGTGCCCT CCAACAAGGA 
0301 ACATCATTAC CGGAACCTCA GAGATCGGTA CACGAACTGT ACGTATGTGG ATGGCAACCT 
0361 GGAGCTGACC TGGCTGCCCA ACGAGAATTT GGACCTCAGC TTCCTGGACA ACATACGGGA 
0421 GGTCACCGGC TATATTCTGA TCAGTCATGT GGACGTTAAG AAAGTGGTAT TTCCCAAACT 
0481 ACAAATCATT CgNGGACGCA CG 
 in silico PCR Fragment
0001 TGCTCCTGGC CCACTGCATT TGCATTTGGC CCGCGTCGGC GGCCCGC-GA TCGCTACGCC 
0061 CGCCAGAACA ATCGCCAGCG CCATCAGGAT ATAGATCGCG ATCGGGATCG AGATCGATTC 
0121 CTATACCGCA GCAGTTCGGC CCAAAATCGA CAGAGGGGCG GGGCCAACT- TCGCCCTGGG 
0181 ACTGGGAGCC AACGGAGTCA CCATTCCCAC CAGTCTGGAG GATAAGAACA AGAACGAGTT 
0241 CGTCAAGGGG AAAATCTGCA TCGGCACTAA ATCTCGGCTC TCCGTGCCCT CCAACAAGGA 
0301 ACATCATTAC CGGAACCTCA GAGATCGGTA CACGAACTGT ACGTATGTGG ATGGCAACCT 
0361 GGAGCTGACC TGGCTGCCCA ACGAGAATTT GGACCTCAGC TTCCTGGACA ACATACGGGA 
0421 GGTCACCGGC TATATTCTGA TCAGTCATGT GGACGTTAAG AAAGTGGTAT TTCCCAAACT 
0481 ACAAATCATT CGCGGACGCA CG 
 Assemble Data

10079R-2.IR_full       1   TGCTCCTGGCCCACTGCATTTGCATTTGGCCCGCGTCGGCGGCCCGCAGATCGCTACGCC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
10079R-2.in silico     1   TGCTCCTGGCCCACTGCATTTGCATTTGGCCCGCGTCGGCGGCCCGC-GATCGCTACGCC 60


10079R-2.IR_full       61  CGCCAGAACAATCGCCAGCGCCATCAGGATATAGATCGCGATCGGGATCGAGATCGATTC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10079R-2.in silico     61  CGCCAGAACAATCGCCAGCGCCATCAGGATATAGATCGCGATCGGGATCGAGATCGATTC 120


10079R-2.IR_full       121 CTATACCGCAGCAGTTCGGCCCAAAATCGACAGAGGGGCGGGGCCAACTNTCGCCCTGGG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
10079R-2.in silico     121 CTATACCGCAGCAGTTCGGCCCAAAATCGACAGAGGGGCGGGGCCAACT-TCGCCCTGGG 180


10079R-2.IR_full       181 ACTGGGAGCCAACGGAGTCACCATTCCCACCAGTCTGGAGGATAAGAACAAGAACGAGTT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10079R-2.in silico     181 ACTGGGAGCCAACGGAGTCACCATTCCCACCAGTCTGGAGGATAAGAACAAGAACGAGTT 240


10079R-2.IR_full       241 CGTCAAGGGGAAAATCTGCATCGGCACTAAATCTCGGCTCTCCGTGCCCTCCAACAAGGA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10079R-2.in silico     241 CGTCAAGGGGAAAATCTGCATCGGCACTAAATCTCGGCTCTCCGTGCCCTCCAACAAGGA 300


10079R-2.IR_full       301 ACATCATTACCGGAACCTCAGAGATCGGTACACGAACTGTACGTATGTGGATGGCAACCT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10079R-2.in silico     301 ACATCATTACCGGAACCTCAGAGATCGGTACACGAACTGTACGTATGTGGATGGCAACCT 360


10079R-2.IR_full       361 GGAGCTGACCTGGCTGCCCAACGAGAATTTGGACCTCAGCTTCCTGGACAACATACGGGA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10079R-2.in silico     361 GGAGCTGACCTGGCTGCCCAACGAGAATTTGGACCTCAGCTTCCTGGACAACATACGGGA 420


10079R-2.IR_full       421 GGTCACCGGCTATATTCTGATCAGTCATGTGGACGTTAAGAAAGTGGTATTTCCCAAACT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10079R-2.in silico     421 GGTCACCGGCTATATTCTGATCAGTCATGTGGACGTTAAGAAAGTGGTATTTCCCAAACT 480


10079R-2.IR_full       481 ACAAATCATTCGNGGACGCACG 502
                           |||||||||||| |||||||||
10079R-2.in silico     481 ACAAATCATTCGCGGACGCACG 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057411.3  CG10079-RB, transcript variant B (Egfr), mRNA 
47.71   230  NM_057410.3  CG10079-RA, transcript variant A (Egfr), mRNA 
0   11  NM_166877.1  CG32811-RA (CG32811), mRNA 
0   10  15  NM_132959.2  CG8949-RA (CG8949), mRNA 
0   35  NM_134738.2  CG4887-RA (CG4887), mRNA 
0   NM_169701.2  CG31045-RB, transcript variant B (Mhcl), mRNA 
0   NM_001043251.1  CG31045-RF, transcript variant F (Mhcl), mRNA 
0   NM_001043250.1  CG31045-RG, transcript variant G (Mhcl), mRNA 
0   NM_169700.2  CG31045-RA, transcript variant A (Mhcl), mRNA 
0   NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   NM_001032053.1  CG33715-RB, transcript variant B (Msp-300), mRNA 
0   NM_206509.1  CG8053-RB, transcript variant B (eIF-1A), mRNA 
0   NM_079989.2  CG8053-RA, transcript variant A (eIF-1A), mRNA 
0   NM_170566.1  CG1856-RE, transcript variant E (ttk), mRNA 
0   NM_170565.1  CG1856-RB, transcript variant B (ttk), mRNA 
0   NM_170564.1  CG1856-RA, transcript variant A (ttk), mRNA 
0   NM_165349.2  CG9339-RG, transcript variant G (CG9339), mRNA 
0   NM_206016.1  CG9339-RH, transcript variant H (CG9339), mRNA 
0   NM_136229.3  CG9339-RA, transcript variant A (CG9339), mRNA 
0   NM_165348.2  CG9339-RE, transcript variant E (CG9339), mRNA 
0   NM_206017.1  CG9339-RD, transcript variant D (CG9339), mRNA 
0   NM_165350.2  CG9339-RB, transcript variant B (CG9339), mRNA 
0   NM_143159.1  CG5028-RA (CG5028), mRNA 
0   NM_170568.1  CG1856-RF, transcript variant F (ttk), mRNA 
0   NM_080172.2  CG1856-RC, transcript variant C (ttk), mRNA 
0   NM_170567.1  CG1856-RD, transcript variant D (ttk), mRNA 
0   NM_001038813.1  CG5983-RB, transcript variant B (ACXC), mRNA 
0   NM_135749.2  CG5983-RA, transcript variant A (ACXC), mRNA 
0   NM_141187.3  CG14643-RA (CG14643), mRNA 
0   NM_143965.1  CG14310-RB, transcript variant B (CG14310), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.