National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10079R-2 
 Symbol Egfr  Full Name Epidermal growth factor receptor 
 CG No CG10079  Old CG No CG10079 
 Synonyms egfr, Elp-B1, EGFR, DER, dEGFR, flb, der, d-egf-r, top, torpedo/egfr, EgfR, CG10079, EGF-R, DER/EGFR, Der, D-EGFR, dEGFR1, Egf-r, Elp, l(2)09261, Egf, EK2-6, c-erbB, DER/torpedo, unnamed, DmHD-33, Elp-B1RB1, Elp-1, DER flb, top/DER, Torpedo/Egfr, D-Egf, Degfr, Torpedo/DER, torpedo/Egfr, EGFr, DER/faint little ball, DER/top, l(2)05351, top/flb, l(2)57DEFa, pnt, l(2)57Ea, l(2)57EFa, HD-33, El, C-erb, Egfr, EFG-R 
 Accession No (Link to NCBI) NM_057411.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Molnar C, Estrada B, de Celis JF.
Tay bridge and extracellular-regulated kinase activity are required for motoneuron function in the Drosophila neural system.
Genes Brain Behav. (2018) e12470 [ PubMed ID = 29524312 ] [ RRC reference ]

Molnar C, de Celis JF.
Tay bridge is a negative regulator of EGFR signalling and interacts with Erk and Mkp3 in the Drosophila melanogaster wing.
PLoS Genet. (2013) 9(12) e1003982 [ PubMed ID = 24348264 ] [ RRC reference ]

Liu M, Lim TM, Cai Y.
The Drosophila female germline stem cell lineage acts to spatially restrict DPP function within the niche.
Sci Signal (2010) 3(132) ra57 [ PubMed ID = 20664066 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Swarup S, Pradhan-Sundd T, Verheyen EM.
Genome-wide identification of phospho-regulators of Wnt signaling in Drosophila.
Development (2015) 142(8) 1502-15 [ PubMed ID = 25852200 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| silico     1   TGCTCCTGGCCCACTGCATTTGCATTTGGCCCGCGTCGGCGGCCCGC-GATCGCTACGCC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CGCCAGAACAATCGCCAGCGCCATCAGGATATAGATCGCGATCGGGATCGAGATCGATTC 120

                           ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| silico     121 CTATACCGCAGCAGTTCGGCCCAAAATCGACAGAGGGGCGGGGCCAACT-TCGCCCTGGG 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ACTGGGAGCCAACGGAGTCACCATTCCCACCAGTCTGGAGGATAAGAACAAGAACGAGTT 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CGTCAAGGGGAAAATCTGCATCGGCACTAAATCTCGGCTCTCCGTGCCCTCCAACAAGGA 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 ACATCATTACCGGAACCTCAGAGATCGGTACACGAACTGTACGTATGTGGATGGCAACCT 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GGAGCTGACCTGGCTGCCCAACGAGAATTTGGACCTCAGCTTCCTGGACAACATACGGGA 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GGTCACCGGCTATATTCTGATCAGTCATGTGGACGTTAAGAAAGTGGTATTTCCCAAACT 480

10079R-2.IR_full       481 ACAAATCATTCGNGGACGCACG 502
                           |||||||||||| ||||||||| silico     481 ACAAATCATTCGCGGACGCACG 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_057411.3  CG10079-RB, transcript variant B (Egfr), mRNA 
47.71   230  NM_057410.3  CG10079-RA, transcript variant A (Egfr), mRNA 
0   11  NM_166877.1  CG32811-RA (CG32811), mRNA 
0   10  15  NM_132959.2  CG8949-RA (CG8949), mRNA 
0   35  NM_134738.2  CG4887-RA (CG4887), mRNA 
0   NM_169701.2  CG31045-RB, transcript variant B (Mhcl), mRNA 
0   NM_001043251.1  CG31045-RF, transcript variant F (Mhcl), mRNA 
0   NM_001043250.1  CG31045-RG, transcript variant G (Mhcl), mRNA 
0   NM_169700.2  CG31045-RA, transcript variant A (Mhcl), mRNA 
0   NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   NM_001032053.1  CG33715-RB, transcript variant B (Msp-300), mRNA 
0   NM_206509.1  CG8053-RB, transcript variant B (eIF-1A), mRNA 
0   NM_079989.2  CG8053-RA, transcript variant A (eIF-1A), mRNA 
0   NM_170566.1  CG1856-RE, transcript variant E (ttk), mRNA 
0   NM_170565.1  CG1856-RB, transcript variant B (ttk), mRNA 
0   NM_170564.1  CG1856-RA, transcript variant A (ttk), mRNA 
0   NM_165349.2  CG9339-RG, transcript variant G (CG9339), mRNA 
0   NM_206016.1  CG9339-RH, transcript variant H (CG9339), mRNA 
0   NM_136229.3  CG9339-RA, transcript variant A (CG9339), mRNA 
0   NM_165348.2  CG9339-RE, transcript variant E (CG9339), mRNA 
0   NM_206017.1  CG9339-RD, transcript variant D (CG9339), mRNA 
0   NM_165350.2  CG9339-RB, transcript variant B (CG9339), mRNA 
0   NM_143159.1  CG5028-RA (CG5028), mRNA 
0   NM_170568.1  CG1856-RF, transcript variant F (ttk), mRNA 
0   NM_080172.2  CG1856-RC, transcript variant C (ttk), mRNA 
0   NM_170567.1  CG1856-RD, transcript variant D (ttk), mRNA 
0   NM_001038813.1  CG5983-RB, transcript variant B (ACXC), mRNA 
0   NM_135749.2  CG5983-RA, transcript variant A (ACXC), mRNA 
0   NM_141187.3  CG14643-RA (CG14643), mRNA 
0   NM_143965.1  CG14310-RB, transcript variant B (CG14310), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.