National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10076R-2 
 Symbol spir  Full Name spire 
 CG No CG10076  Old CG No CG10076 
 Synonyms p150Spir, p150-Spir, 38C.37, 38C.34, l(2)08327, CG10076, Spir, CG18621, spir 
 Accession No (Link to NCBI) NM_165323.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Fairchild MJ, Islam F, Tanentzapf G.
Identification of genetic networks that act in the somatic cells of the testis to mediate the developmental program of spermatogenesis.
PLoS Genet. (2017) 13(9) e1007026 [ PubMed ID = 28957323 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGAAGACGCCTTCCTGTCCAC 
 Primer Seq. 3'
aatctagaggtaccACGCTCTGTTGATGACGCTGC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGAAGACGCC TTCCTGTCCA CATCGCCGGA CAGCGCCAAC GgcGATGCCC AACACAAGCT 
0061 GCCAGCGNAC CAGCTGgcCA TGTCCTCCAG TGCGCATCCC CAGCAGGCGG GCCAAgcccG 
0121 CCCNCNCATN CCTGCAAGCC TTCCACCGCT GCTCCTCGCC AGAACAGTGC GTCACGNTGC 
0181 ACGACATCCT GGACTCCTTT AAGGCGCCGC TCTCCGAGGA CCAGGCCTGG GCCCTGATCC 
0241 ACCAGTTCGC CGGGCTCTAC CACCAGGTGG CCGTACAAGC GCACACCTGT GCCGCGGACT 
0301 ACGAGGCCGC CCTGCCCACC GGATTCGAGC TGCACTTCCA TCGCGACGGC AGCGTCCACT 
0361 TCTCCGGCCC GGATCAGCTG ACGCCTAAGG AGCAACTGCA GCAGGAGCAG ATCCCCCTCC 
0421 CCCCGCAGCA CGACGTGATT GTGGATCAGC CGGACCACAG CGCCAGCAGC AGCGGCGACA 
0481 GCAGCGTCAT CAACAGAGCG T 
 in silico PCR Fragment
0001 GGAAGACGCC TTCCTGTCCA CATCGCCGGA CAGCGCCAAC GGCGATGCCC AACACAAGCT 
0061 GCCAGCGGAC CAGCTGGCCA TGTCCTCCAG TGCGCATCCC CAGCAGGCGG GCCAAGCCCG 
0121 CCCGCTCAT- CCTGCAAGCC TTCCACCGCT GCTCCTCGCC AGAACAGTGC GTCACGCTGC 
0181 ACGACATCCT GGACTCCTTT AAGGCGCCGC TCTCCGAGGA CCAGGCCTGG GCCCTGATCC 
0241 ACCAGTTCGC CGGGCTCTAC CACCAGGTGG CCGTACAAGC GCACACCTGT GCCGCGGACT 
0301 ACGAGGCCGC CCTGCCCACC GGATTCGAGC TGCACTTCCA TCGCGACGGC AGCGTCCACT 
0361 TCTCCGGCCC GGATCAGCTG ACGCCTAAGG AGCAACTGCA GCAGGAGCAG ATCCCCCTCC 
0421 CCCCGCAGCA CGACGTGATT GTGGATCAGC CGGACCACAG CGCCAGCAGC AGCGGCGACA 
0481 GCAGCGTCAT CAACAGAGCG T 
 Assemble Data

10076R-2.IR_full       1   GGAAGACGCCTTCCTGTCCACATCGCCGGACAGCGCCAACGGCGATGCCCAACACAAGCT 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10076R-2.in silico     1   GGAAGACGCCTTCCTGTCCACATCGCCGGACAGCGCCAACGGCGATGCCCAACACAAGCT 60


10076R-2.IR_full       61  GCCAGCGNACCAGCTGGCCATGTCCTCCAGTGCGCATCCCCAGCAGGCGGGCCAAGCCCG 120
                           ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
10076R-2.in silico     61  GCCAGCGGACCAGCTGGCCATGTCCTCCAGTGCGCATCCCCAGCAGGCGGGCCAAGCCCG 120


10076R-2.IR_full       121 CCCNCNCATNCCTGCAAGCCTTCCACCGCTGCTCCTCGCCAGAACAGTGCGTCACGNTGC 180
                           ||| | ||| |||||||||||||||||||||||||||||||||||||||||||||| |||
10076R-2.in silico     121 CCCGCTCAT-CCTGCAAGCCTTCCACCGCTGCTCCTCGCCAGAACAGTGCGTCACGCTGC 180


10076R-2.IR_full       181 ACGACATCCTGGACTCCTTTAAGGCGCCGCTCTCCGAGGACCAGGCCTGGGCCCTGATCC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10076R-2.in silico     181 ACGACATCCTGGACTCCTTTAAGGCGCCGCTCTCCGAGGACCAGGCCTGGGCCCTGATCC 240


10076R-2.IR_full       241 ACCAGTTCGCCGGGCTCTACCACCAGGTGGCCGTACAAGCGCACACCTGTGCCGCGGACT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10076R-2.in silico     241 ACCAGTTCGCCGGGCTCTACCACCAGGTGGCCGTACAAGCGCACACCTGTGCCGCGGACT 300


10076R-2.IR_full       301 ACGAGGCCGCCCTGCCCACCGGATTCGAGCTGCACTTCCATCGCGACGGCAGCGTCCACT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10076R-2.in silico     301 ACGAGGCCGCCCTGCCCACCGGATTCGAGCTGCACTTCCATCGCGACGGCAGCGTCCACT 360


10076R-2.IR_full       361 TCTCCGGCCCGGATCAGCTGACGCCTAAGGAGCAACTGCAGCAGGAGCAGATCCCCCTCC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10076R-2.in silico     361 TCTCCGGCCCGGATCAGCTGACGCCTAAGGAGCAACTGCAGCAGGAGCAGATCCCCCTCC 420


10076R-2.IR_full       421 CCCCGCAGCACGACGTGATTGTGGATCAGCCGGACCACAGCGCCAGCAGCAGCGGCGACA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10076R-2.in silico     421 CCCCGCAGCACGACGTGATTGTGGATCAGCCGGACCACAGCGCCAGCAGCAGCGGCGACA 480


10076R-2.IR_full       481 GCAGCGTCATCAACAGAGCGT 501
                           |||||||||||||||||||||
10076R-2.in silico     481 GCAGCGTCATCAACAGAGCGT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165323.1  CG10076-RA, transcript variant A (spir), mRNA 
100   482  NM_080115.2  CG10076-RB, transcript variant B (spir), mRNA 
100   482  NM_165324.1  CG10076-RD, transcript variant D (spir), mRNA 
0.82   NM_135727.1  CG5418-RA (CG5418), mRNA 
0.41   NM_134577.1  CG1529-RA (CG1529), mRNA 
0.2   18  54  NM_167330.2  CG17762-RD, transcript variant D (tomosyn), mRNA 
0.2   12  27  NM_167329.2  CG17762-RC, transcript variant C (tomosyn), mRNA 
0.2   12  27  NM_167328.2  CG17762-RA, transcript variant A (tomosyn), mRNA 
0.2   12  18  NM_132591.3  CG17762-RB, transcript variant B (tomosyn), mRNA 
0   15  107  NM_132246.2  CG10555-RA (CG10555), mRNA 
0   29  101  NM_169696.1  CG3992-RA, transcript variant A (srp), mRNA 
0   29  101  NM_169694.1  CG3992-RB, transcript variant B (srp), mRNA 
0   NM_164710.1  CG17378-RB, transcript variant B (CG17378), mRNA 
0   NM_135229.2  CG17378-RA, transcript variant A (CG17378), mRNA 
0   NM_135936.2  CG4993-RB, transcript variant B (PRL-1), mRNA 
0   NM_165150.1  CG4993-RA, transcript variant A (PRL-1), mRNA 
0   28  91  NM_078514.2  CG9653-RA (brk), mRNA 
0   17  50  NM_206356.2  CG33261-RB, transcript variant B (Trl), mRNA 
0   16  79  NM_168113.2  CG32423-RD, transcript variant D (alan-shepard), mRNA 
0   14  90  NM_001038965.1  CG9924-RE, transcript variant E (CG9924), mRNA 
0   14  41  NM_001038926.1  CG33261-RI, transcript variant I (Trl), mRNA 
0   11  25  NM_167388.1  CG32606-RA (CG32606), mRNA 
0   76  NM_001038742.1  CG6824-RD, transcript variant D (ovo), mRNA 
0   76  NM_080338.3  CG6824-RA, transcript variant A (ovo), mRNA 
0   101  NM_132172.2  CG15478-RA (CG15478), mRNA 
0   65  NM_132413.1  CG15295-RA (CG15295), mRNA 
0   51  NM_141636.1  CG16777-RA (CG16777), mRNA 
0   13  NM_136527.1  CG14755-RA (CG14755), mRNA 
0   25  55  NM_001014527.1  CG8787-RB, transcript variant B (Asx), mRNA 
0   25  55  NM_166057.1  CG8787-RA, transcript variant A (Asx), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.