National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10067R-1 
 Symbol Act57B  Full Name Actin 57B 
 CG No CG10067  Old CG No CG10067 
 Synonyms Actin, actin, CG10067, T10, C, CG30294, act 57A, M, act57A, Act57A, BEST:RE38067, anon-EST:CL2c12, Act57B 
 Accession No (Link to NCBI) NM_079076.3 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Nakaoka T, Iga M, Yamada T, Koujima I, Takeshima M, Zhou X, Suzuki Y, Ogihara MH, Kataoka H.
Deep sequencing of the prothoracic gland transcriptome reveals new players in insect ecdysteroidogenesis.
PLoS ONE (2017) 12(3) e0172951 [ PubMed ID = 28257485 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGAAGTTGCTGCTCTGGTCGT 
 Primer Seq. 3'
aatctagaggtaccCATAACCCTCATAGATGGGGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGAAGTTGCT GCTCTGGTCG TTGACAATGG CTCCGGCATG TGCAAGGCCg GTTTCGCCGG 
0061 TGATGACGCT CCCCGTGCCG TCTTCCCCTC CATCGTCGGT CGTCCACGCC ACCAGGGTGT 
0121 GATGGTCGGT ATGGGCCAGA AGGACTCGTA CGTCGGTGAT GAGGCCCAGT CCAAGCGTGG 
0181 TATCCTCACC CTGAAATACC CCATCGAGCA CGGTATCATC ACCAACTGGG ATGATATGGA 
0241 GAAGATCTGG CACCACACCT TCTACAACGA GCTGCGTGTT GCCCCCGAGG AGCACCCCGT 
0301 CCTGCTGACT GAGGCCCCCC TGAACCCCAA GGCTAACCGC GAGAAGATGA CCCAGATCAT 
0361 GTTTGAGACC TTCAACTCGC CCGCCATGTA CGTCGCCATC CAGGCCGTGC TCTCCCTGTA 
0421 CGCCTCCGGT CGTACCACCG GTATCGTTCT GGACTCCGGT GATGGTGTCT CCCACACCGT 
0481 CCCCATCTAT GAGGGTTATG  
 in silico PCR Fragment
0001 TGAAGTTGCT GCTCTGGTCG TTGACAATGG CTCCGGCATG TGCAAGGCCG GTTTCGCCGG 
0061 TGATGACGCT CCCCGTGCCG TCTTCCCCTC CATCGTCGGT CGTCCACGCC ACCAGGGTGT 
0121 GATGGTCGGT ATGGGCCAGA AGGACTCGTA CGTCGGTGAT GAGGCCCAGT CCAAGCGTGG 
0181 TATCCTCACC CTGAAATACC CCATCGAGCA CGGTATCATC ACCAACTGGG ATGATATGGA 
0241 GAAGATCTGG CACCACACCT TCTACAACGA GCTGCGTGTT GCCCCCGAGG AGCACCCCGT 
0301 CCTGCTGACT GAGGCCCCCC TGAACCCCAA GGCTAACCGC GAGAAGATGA CCCAGATCAT 
0361 GTTTGAGACC TTCAACTCGC CCGCCATGTA CGTCGCCATC CAGGCCGTGC TCTCCCTGTA 
0421 CGCCTCCGGT CGTACCACCG GTATCGTTCT GGACTCCGGT GATGGTGTCT CCCACACCGT 
0481 CCCCATCTAT GAGGGTTATG  
 Assemble Data

10067R-1.IR_full       1   TGAAGTTGCTGCTCTGGTCGTTGACAATGGCTCCGGCATGTGCAAGGCCGGTTTCGCCGG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10067R-1.in silico     1   TGAAGTTGCTGCTCTGGTCGTTGACAATGGCTCCGGCATGTGCAAGGCCGGTTTCGCCGG 60


10067R-1.IR_full       61  TGATGACGCTCCCCGTGCCGTCTTCCCCTCCATCGTCGGTCGTCCACGCCACCAGGGTGT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10067R-1.in silico     61  TGATGACGCTCCCCGTGCCGTCTTCCCCTCCATCGTCGGTCGTCCACGCCACCAGGGTGT 120


10067R-1.IR_full       121 GATGGTCGGTATGGGCCAGAAGGACTCGTACGTCGGTGATGAGGCCCAGTCCAAGCGTGG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10067R-1.in silico     121 GATGGTCGGTATGGGCCAGAAGGACTCGTACGTCGGTGATGAGGCCCAGTCCAAGCGTGG 180


10067R-1.IR_full       181 TATCCTCACCCTGAAATACCCCATCGAGCACGGTATCATCACCAACTGGGATGATATGGA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10067R-1.in silico     181 TATCCTCACCCTGAAATACCCCATCGAGCACGGTATCATCACCAACTGGGATGATATGGA 240


10067R-1.IR_full       241 GAAGATCTGGCACCACACCTTCTACAACGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10067R-1.in silico     241 GAAGATCTGGCACCACACCTTCTACAACGAGCTGCGTGTTGCCCCCGAGGAGCACCCCGT 300


10067R-1.IR_full       301 CCTGCTGACTGAGGCCCCCCTGAACCCCAAGGCTAACCGCGAGAAGATGACCCAGATCAT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10067R-1.in silico     301 CCTGCTGACTGAGGCCCCCCTGAACCCCAAGGCTAACCGCGAGAAGATGACCCAGATCAT 360


10067R-1.IR_full       361 GTTTGAGACCTTCAACTCGCCCGCCATGTACGTCGCCATCCAGGCCGTGCTCTCCCTGTA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10067R-1.in silico     361 GTTTGAGACCTTCAACTCGCCCGCCATGTACGTCGCCATCCAGGCCGTGCTCTCCCTGTA 420


10067R-1.IR_full       421 CGCCTCCGGTCGTACCACCGGTATCGTTCTGGACTCCGGTGATGGTGTCTCCCACACCGT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10067R-1.in silico     421 CGCCTCCGGTCGTACCACCGGTATCGTTCTGGACTCCGGTGATGGTGTCTCCCACACCGT 480


10067R-1.IR_full       481 CCCCATCTATGAGGGTTATG 500
                           ||||||||||||||||||||
10067R-1.in silico     481 CCCCATCTATGAGGGTTATG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079076.3  CG10067-RA, transcript variant A (Act57B), mRNA 
96.68   466  NM_166414.1  CG10067-RB, transcript variant B (Act57B), mRNA 
13.07   63  158  154  65  NM_001014726.1  CG4027-RC, transcript variant C (Act5C), mRNA 
13.07   63  158  154  65  NM_001014725.1  CG4027-RD, transcript variant D (Act5C), mRNA 
13.07   63  158  154  65  NM_167053.1  CG4027-RA, transcript variant A (Act5C), mRNA 
13.07   63  158  154  65  NM_078497.2  CG4027-RB, transcript variant B (Act5C), mRNA 
11.61   56  126  142  105  NM_169525.1  CG18290-RB, transcript variant B (Act87E), mRNA 
11.61   56  126  142  105  NM_057743.3  CG18290-RA, transcript variant A (Act87E), mRNA 
11.41   55  148  132  69  NM_079643.1  CG5178-RA (Act88F), mRNA 
10.58   51  158  102  95  NM_079486.3  CG7478-RA (Act79B), mRNA 
0.2   NM_143725.2  CG18039-RA (KaiRIA), mRNA 
0   40  159  149  NM_078901.2  CG12051-RA (Act42A), mRNA 
0   13  52  NM_057689.1  CG5409-RA (Arp53D), mRNA 
0   NM_057627.3  CG8996-RB, transcript variant B (wal), mRNA 
0   NM_165847.1  CG8996-RA, transcript variant A (wal), mRNA 
0   NM_141038.2  CG9389-RA (CG9389), mRNA 
0   NM_057258.2  CG10699-RA, transcript variant A (Lim3), mRNA 
0   NM_165277.1  CG10699-RB, transcript variant B (Lim3), mRNA 
0   NM_078648.2  CG9901-RA (Arp14D), mRNA 
0   NM_168072.1  CG15010-RA, transcript variant A (ago), mRNA 
0   NM_168073.1  CG15010-RB, transcript variant B (ago), mRNA 
0   NM_079198.2  CG15010-RC, transcript variant C (ago), mRNA 
0   NM_001038734.1  CG16902-RC (Hr4), mRNA 
0   NM_001042804.1  CG2174-RB, transcript variant B (Myo10A), mRNA 
0   NM_132441.1  CG2174-RA, transcript variant A (Myo10A), mRNA 
0   NM_001042881.1  CG8486-RC, transcript variant C (CG8486), mRNA 
0   NM_164795.2  CG8486-RB, transcript variant B (CG8486), mRNA 
0   NM_135344.2  CG8486-RA, transcript variant A (CG8486), mRNA 
0   26  NM_079607.2  CG6174-RA (Arp87C), mRNA 
0   20  NM_079244.2  CG7558-RA (Arp66B), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.