National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 1004R-3 
 Symbol rho  Full Name rhomboid 
 CG No CG1004  Old CG No CG1004 
 Synonyms Rho-1, CG1004, Rho1, rhomboid/veinlet, ve, rho1, rho-1, Rho, DMRHOb, RHO, rhom, RHOb, DMRHO, DRORHO, Ve, DMRHOa, rho 
 Accession No (Link to NCBI) NM_079159.2 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| silico     1   TGGTTCCACCTGGGCTTCAATATCGTCATCCAGCTGTTTTTTGGCATTCCCCTGGAGGTG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ATGCACGGCACGGCCAGGATCGGCGTGATCTACATGGCGGGCGTTTTTGCCGGATCCCTG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GGCACCAGTGTCGTCGACTCGGAGGTCTTCCTGGTGGGCGCCAGCGGTGGCGTCTATGCC 180

                          ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CTGTTGGCCGCACATCTGGCCAACATTACACTGAACTATGCGCACATGAAGAGCGCATCC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ACGCAACTCGGATCCGTTGTCATCTTTGTCTCCTGCGATCTGGGCTATGCTCTCTACACC 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CAATACTTCGATGGAAGCGCCTTCGCCAAGGGTCCCCAGGTGTCGTACATTGCCCACCTG 360

                          |||||||||||||||||||||||||||||||| ||||||||||||||||||||||| || silico     361 ACGGGAGCCCTGGCAGGACTAACGATCGGCTTTCTGGTGCTAAAGAACTTCGGTCACCGA 420

                          |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| silico     421 GAGTACGAGCAGCTCATCTGGTGGCTAGCGTTGGGCGTCTACTGTGCCTTCACCGTCTTC 480

1004R-3.IR_full       481 GCCATCGTTTTCAACCTGAT 500
                          |||||||||||||||||||| silico     481 GCCATCGTTTTCAACCTGAT 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079159.2  CG1004-RA (rho), mRNA 
0   NM_132478.1  CG11757-RA (CG11757), mRNA 
0   NM_080296.2  CG16785-RA (fz3), mRNA 
0   NM_170158.1  CG5794-RB, transcript variant B (CG5794), mRNA 
0   NM_143018.2  CG5794-RD, transcript variant D (CG5794), mRNA 
0   NM_206564.1  CG5794-RE, transcript variant E (CG5794), mRNA 
0   NM_206683.2  CG1725-RB, transcript variant B (dlg1), mRNA 
0   NM_206681.2  CG1725-RH, transcript variant H (dlg1), mRNA 
0   NM_206684.2  CG1725-RE, transcript variant E (dlg1), mRNA 
0   NM_206682.2  CG1725-RG, transcript variant G (dlg1), mRNA 
0   NM_078565.3  CG1725-RD, transcript variant D (dlg1), mRNA 
0   NM_167282.2  CG1725-RA, transcript variant A (dlg1), mRNA 
0   NM_134493.2  CG14214-RA (Sec61gamma), mRNA 
0   NM_137997.2  CG5597-RA (CG5597), mRNA 
0   NM_137971.2  CG5428-RA (CG5428), mRNA 
0   NM_079865.3  CG1480-RA (bnk), mRNA 
0   NM_142524.2  CG6040-RA (CG6040), mRNA 
0   NM_142157.1  CG6974-RA (CG6974), mRNA 
0   NM_139913.1  CG13681-RA (CG13681), mRNA 
0   NM_141850.2  CG14718-RA (CG14718), mRNA 
0   NM_142834.2  CG6985-RA (CG6985), mRNA 
0   NM_168755.1  CG8127-RB, transcript variant B (Eip75B), mRNA 
0   NM_080148.2  CG2522-RA (Gtp-bp), mRNA 
0   NM_079321.2  CG10571-RA (ara), mRNA 
0   NM_136894.1  CG8860-RA (CG8860), mRNA 
0   NM_144381.1  CG15378-RA (lectin-22C), mRNA 
0   NM_164752.2  CG12789-RA, transcript variant A (CG12789), mRNA 
0   NM_135277.2  CG12789-RB, transcript variant B (CG12789), mRNA 
0   NM_080104.2  CG4032-RA (Abl), mRNA 
0   NM_132749.1  CG9521-RA (CG9521), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.