National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10033R-1 
 Symbol for  Full Name foraging 
 CG No CG10033  Old CG No CG10033 
 Synonyms FOR/PKG, 142251_at, dg2, CG10033, DG2, PKG, l(2)06860, Pkg24A, Pkg2, Dg2, BcDNA:GM08338, anon-WO02059370.47, anon-WO0140519.260, for 
 Accession No (Link to NCBI) NM_058139.3 
 Inserted Chr. ll 
 Insertional Mutation  semi-lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Swarup S, Pradhan-Sundd T, Verheyen EM.
Genome-wide identification of phospho-regulators of Wnt signaling in Drosophila.
Development (2015) 142(8) 1502-15 [ PubMed ID = 25852200 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGCGTTTCTGCTTTGATCGGC 
 Primer Seq. 3'
aatctagaggtaccTGCTTTTCGTAACGCCTCCGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGCGTTTCTG CTTTGATCGG CtgTGTCTGT CGCAACCAAG CGGCCAGCCC AAAACTCCAA 
0061 CAGCAATGCA CCACACAGCA GCACCACAGT AGATGCACCA CCACGTCCAG CGGATGTAGA 
0121 TGTAGCCACT GTACCAGTAG CAACACCAGC ACCACCACCA CAACAGCCAG TTAGTAATCT 
0181 GTTCTATGCC GACTACCAGA AGCTGCAGCC GGCGATAATC GATCGGGACT GGGAGCGGGA 
0241 CAGAGATACA GATACAGATA CCAGGAGCGA GGCCAAGCCA CCGGACATTG TGGAGCACAT 
0301 AGAACCCGTA GAGGAGCAGA GACAGATACA CACACAGATA CAGTCGCCGG CAGAGATACA 
0361 GATACAGATA CCCCCGACGC CCCCTGCCCC ATCGATACAG ATACAGATAC AGCAGcGCTA 
0421 TCGCCGGCAC AGCAGTGCCG AAGATCGCAA TCTGAACACG AGGCGAAACG ATTCGAATAT 
0481 TACGGAGGCG TTACGAAAAG CA 
 in silico PCR Fragment
0001 TGCGTTTCTG CTTTGATCGG CTGTG-CT-T CGCAACCAAG CGGCCAGCCC AAAACTCCAA 
0061 CAGCAATGCA CCACACAGCA GCACCACAGT AGATGCACCA CCACGTCCAG CGGATGTAGA 
0121 TGTAGCCACT GTACCAGTAG CAACACCAGC ACCACCACCA CAACAGCCAG TTAGTAATCT 
0181 GTTCTATGCC GACTACCAGA AGCTGCAGCC GGCGATAATC GATCGGGACT GGGAGCGGGA 
0241 CAGAGATACA GATACAGATA CCAGGAGCGA GGCCAAGCCA CCGGACATTG TGGAGCACAT 
0301 AGAACCCGTA GAGGAGCAGA GACAGATACA CACACAGATA CAGTCGCCGG CAGAGATACA 
0361 GATACAGATA CCCCCGACGC CCCCTGCCCC ATCGATACAG ATACAGATAC AGCAGCGCTA 
0421 TCGCCGGCAC AGCAGTGCCG AAGATCGCAA TCTGAACACG AGGCGAAACG ATTCGAATAT 
0481 TACGGAGGCG TTACGAAAAG CA 
 Assemble Data

10033R-1.IR_full       1   TGCGTTTCTGCTTTGATCGGCTGTGTCTGTCGCAACCAAGCGGCCAGCCCAAAACTCCAA 60
                           ||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||
10033R-1.in silico     1   TGCGTTTCTGCTTTGATCGGCTGTG-CT-TCGCAACCAAGCGGCCAGCCCAAAACTCCAA 60


10033R-1.IR_full       61  CAGCAATGCACCACACAGCAGCACCACAGTAGATGCACCACCACGTCCAGCGGATGTAGA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10033R-1.in silico     61  CAGCAATGCACCACACAGCAGCACCACAGTAGATGCACCACCACGTCCAGCGGATGTAGA 120


10033R-1.IR_full       121 TGTAGCCACTGTACCAGTAGCAACACCAGCACCACCACCACAACAGCCAGTTAGTAATCT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10033R-1.in silico     121 TGTAGCCACTGTACCAGTAGCAACACCAGCACCACCACCACAACAGCCAGTTAGTAATCT 180


10033R-1.IR_full       181 GTTCTATGCCGACTACCAGAAGCTGCAGCCGGCGATAATCGATCGGGACTGGGAGCGGGA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10033R-1.in silico     181 GTTCTATGCCGACTACCAGAAGCTGCAGCCGGCGATAATCGATCGGGACTGGGAGCGGGA 240


10033R-1.IR_full       241 CAGAGATACAGATACAGATACCAGGAGCGAGGCCAAGCCACCGGACATTGTGGAGCACAT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10033R-1.in silico     241 CAGAGATACAGATACAGATACCAGGAGCGAGGCCAAGCCACCGGACATTGTGGAGCACAT 300


10033R-1.IR_full       301 AGAACCCGTAGAGGAGCAGAGACAGATACACACACAGATACAGTCGCCGGCAGAGATACA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10033R-1.in silico     301 AGAACCCGTAGAGGAGCAGAGACAGATACACACACAGATACAGTCGCCGGCAGAGATACA 360


10033R-1.IR_full       361 GATACAGATACCCCCGACGCCCCCTGCCCCATCGATACAGATACAGATACAGCAGCGCTA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10033R-1.in silico     361 GATACAGATACCCCCGACGCCCCCTGCCCCATCGATACAGATACAGATACAGCAGCGCTA 420


10033R-1.IR_full       421 TCGCCGGCACAGCAGTGCCGAAGATCGCAATCTGAACACGAGGCGAAACGATTCGAATAT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
10033R-1.in silico     421 TCGCCGGCACAGCAGTGCCGAAGATCGCAATCTGAACACGAGGCGAAACGATTCGAATAT 480


10033R-1.IR_full       481 TACGGAGGCGTTACGAAAAGCA 502
                           ||||||||||||||||||||||
10033R-1.in silico     481 TACGGAGGCGTTACGAAAAGCA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
101.65  490  33  52  NM_058139.3  CG10033-RA, transcript variant A (for), mRNA 
101.65  490  33  52  NM_205904.1  CG10033-RI, transcript variant I (for), mRNA 
101.65  490  33  52  NM_205906.1  CG10033-RH, transcript variant H (for), mRNA 
1.03   20  38  41  NM_166453.1  CG30282-RA (CG30282), mRNA 
1.03   12  25  26  NM_206186.2  CG13439-RA (dpr), mRNA 
1.03   12  24  NM_080377.2  CG10207-RA (NaPi-T), mRNA 
0.62   32  62  105  NM_132042.1  CG11462-RA (CG11462), mRNA 
0.62   21  NM_169453.1  CG10095-RA (dpr15), mRNA 
0.41   22  38  42  NM_135676.2  CG14940-RA (Pde1c), mRNA 
0.2   20  42  89  NM_137912.1  CG9876-RA (CG9876), mRNA 
0.2   16  35  82  NM_140928.2  CG32223-RA (CG32223), mRNA 
0.2   10  29  59  NM_141665.2  CG8348-RA (Dh), mRNA 
0.2   20  29  NM_130604.2  CG17766-RA (CG17766), mRNA 
0.2   10  NM_168903.2  CG5683-RA, transcript variant A (Aef1), mRNA 
0.2   10  NM_168904.2  CG5683-RC, transcript variant C (Aef1), mRNA 
0.2   10  NM_079476.2  CG5683-RB, transcript variant B (Aef1), mRNA 
0.2   15  40  NM_168489.1  CG32096-RC, transcript variant C (rols), mRNA 
0.2   15  40  NM_168488.1  CG32096-RA, transcript variant A (rols), mRNA 
0.2   15  40  NM_168490.1  CG32096-RE, transcript variant E (rols), mRNA 
0.2   15  40  NM_140285.2  CG32096-RD, transcript variant D (rols), mRNA 
0.2   25  NM_079853.2  CG15532-RA, transcript variant A (hdc), mRNA 
0.2   25  NM_176591.1  CG15532-RC, transcript variant C (hdc), mRNA 
0   12  24  40  NM_143973.2  CG17278-RA (CG17278), mRNA 
0   10  30  44  NM_131977.1  CG6789-RA (CG6789), mRNA 
0   17  31  NM_078714.5  CG9559-RA, transcript variant A (fog), mRNA 
0   17  31  NM_001038771.2  CG9559-RB, transcript variant B (fog), mRNA 
0   19  38  NM_001032406.1  CG33956-RB, transcript variant B (kay), mRNA 
0   11  42  NM_206191.1  CG15669-RF, transcript variant F (MESK2), mRNA 
0   11  42  NM_079080.2  CG15669-RD, transcript variant D (MESK2), mRNA 
0   11  42  NM_206190.1  CG15669-RE, transcript variant E (MESK2), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.