National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 10006R-6 
 Symbol CG10006  Full Name CG10006 
 CG No CG10006  Old CG No CG10006 
 Synonyms CG10006 
 Accession No (Link to NCBI) NM_140475.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS One (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GCCGCATGCCACAAATGTAACGTATTACTTTGAGCCGACACGAGTCAATGCCACCGATGA 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GGAAGCTTTGGAGCTGCAAATCTCTCCTCGTGGCAATCACTCAAATTCACAGTCGGAGGC 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CGAGGTTCCGGAGTTCCTAGAAATTCATGACCCCAAGCACCGACATCCGAGGGAGAGTTC 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TGAACCTGTTGCCGCTTGCTTATCACCGAAGTCTTTACTTTCCCTCATCGTGAACCACAA 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CGATCTCCACAAAAACATTGCCTACCGCAAGCTGCTCATTAAGAATGACGTTAGCTCAAC 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TGATGGCGTCCACAATTCTGAAGAGGAATACAACGAATTCATCAACTCGGTGCGGATCAC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TCCGCGAGCTTTTATGAAACTCTGTCCAGCTCTATTAGCCCAGATCGATAATGGAGTTTG 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CAAGCAACCAGCTGTACGATCAGTAAACCTTAACGATAAGAACCAGAAGATATGGTACGC 480

10006R-6.IR_full       481 TTGGATCTATGCCAGCATCA 500
                           |||||||||||||||||||| silico     481 TTGGATCTATGCCAGCATCA 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_140475.1  CG10006-RA (CG10006), mRNA 
0.2   NM_165818.1  CG30033-RB (CG30033), mRNA 
0   NM_139701.1  CG4769-RA (CG4769), mRNA 
0   NM_001038858.1  CG8585-RB, transcript variant B (Ih), mRNA 
0   NM_001038859.1  CG8585-RE, transcript variant E (Ih), mRNA 
0   NM_001038856.1  CG8585-RC, transcript variant C (Ih), mRNA 
0   NM_001038857.1  CG8585-RD, transcript variant D (Ih), mRNA 
0   NM_135957.2  CG31738-RB, transcript variant B (CG31738), mRNA 
0   NM_131923.2  CG6121-RA (Tip60), mRNA 
0   NM_058161.3  CG5595-RA (Sce), mRNA 
0   NM_140842.1  CG9629-RA (CG9629), mRNA 
0   NM_080713.3  CG10746-RA (fok), mRNA 
0   NM_169846.1  CG31043-RB, transcript variant B (gukh), mRNA 
0   NM_001032021.1  CG31043-RC, transcript variant C (gukh), mRNA 
0   NM_169845.1  CG31043-RA, transcript variant A (gukh), mRNA 
0   NM_141732.1  CG3999-RA (CG3999), mRNA 
0   NM_137570.1  CG10051-RA (CG10051), mRNA 
0   NM_168753.1  CG5535-RB, transcript variant B (CG5535), mRNA 
0   NM_140762.1  CG5535-RA, transcript variant A (CG5535), mRNA 
0   NM_176229.1  CG33147-RA (CG33147), mRNA 
0   NM_138036.2  CG3209-RA, transcript variant A (CG3209), mRNA 
0   NM_143380.3  CG1520-RA, transcript variant A (WASp), mRNA 
0   NM_170378.2  CG1520-RB, transcript variant B (WASp), mRNA 
0   NM_176578.1  CG1520-RC, transcript variant C (WASp), mRNA 
0   NM_132267.4  CG12109-RB (Caf1-180), mRNA 
0   NM_132849.1  CG15602-RA (CG15602), mRNA 
0   NM_165011.2  CG31764-RB, transcript variant B (vir-1), mRNA 
0   NM_140821.2  CG3819-RA (CG3819), mRNA 
0   NM_165010.2  CG31764-RA, transcript variant A (vir-1), mRNA 
0   NM_143367.2  CG10011-RA (CG10011), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.