National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9997R-3 
 Symbol CG9997  Full Name CG9997 
 CG No CG9997  Old CG No CG9997 
 Synonyms CG9997 
 Accession No (Link to NCBI) NM_143374.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr. Biol. (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCTGCGACCACTGTGCATTAT 
 Primer Seq. 3'
aatctagaggtaccCTTCGAGGACTTCGTCATCGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCTGCGACCA CTGTGCATTA TTCAGATCCT TTTGCTCGCT TTCCTGGCGA ACGAGTCGGA 
0061 ATCCTCGAAC ACTCATCTCC ATCGCTATAT GCTGGACACC TATAAGCCGC AGCACAATCG 
0121 AAAAACCCAA ATGAACTACA AACGACGCCG TACTGTAAGG AGCGATCACG AAATGGCTAT 
0181 CGATCCCAAT AATCCAAATA ATCCCAATAA TCCAAATAAT TCCGATAGTC CCGATAATCC 
0241 CAATAATCTC AATAATCCAA ATAATCCGAA TAATGACACA GTACAGTATG GACATTCCAA 
0301 GGAGCCTGTA GTTACCTTGA CCAATTCGGA CAAGANAGGT GCCGCTGCAC GAGCTGATGG 
0361 TGAGACTCTA TCAGCAAAAC AAATATATCT GCATGGGCAC GGTGATATCC GAGATGCTAG 
0421 TGATTACCAC TAGCACTTGT TTTAATTTGG CCAGCAGTGA TGTGGTCACG ATGAAGATGT 
0481 ACGATGACGA AGTCCTCGAA G 
 in silico PCR Fragment
0001 GCTGCGACCA CTGTGCATTA TTCAGATCCT TTTGCTCGCT TTCCTGGCGA ACGAGTCGGA 
0061 ATCCTCGAAC ACTCATCTCC ATCGCTATAT GCTGGACACC TATAAGCCGC AGCACAATCG 
0121 AAAAACCCAA ATGAACTACA AACGACGCCG TACTGTAAGG AGCGATCACG AAATGGCTAT 
0181 CGATCCCAAT AATCCAAATA ATCCCAATAA TCCAAATAAT TCCGATAGTC CCGATAATCC 
0241 CAATAATCTC AATAATCCAA ATAATCCGAA TAATGACACA GTACAGTATG GACATTCCAA 
0301 GGAGCCTGTA GTTACCTTGA CCAATTCGGA CAAGA-AGGT GCCGCTGCAC GAGCTGATGG 
0361 TGAGACTCTA TCAGCAAAAC AAATATATCT GCATGGGCAC GGTGATATCC GAGATGCTAG 
0421 TGATTACCAC TAGCACTTGT TTTAATTTGG CCAGCAGTGA AGTGGTCACG ATGAAGATGT 
0481 ACGATGACGA AGTCCTCGAA G 
 Assemble Data

9997R-3.IR_full       1   GCTGCGACCACTGTGCATTATTCAGATCCTTTTGCTCGCTTTCCTGGCGAACGAGTCGGA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9997R-3.in silico     1   GCTGCGACCACTGTGCATTATTCAGATCCTTTTGCTCGCTTTCCTGGCGAACGAGTCGGA 60


9997R-3.IR_full       61  ATCCTCGAACACTCATCTCCATCGCTATATGCTGGACACCTATAAGCCGCAGCACAATCG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9997R-3.in silico     61  ATCCTCGAACACTCATCTCCATCGCTATATGCTGGACACCTATAAGCCGCAGCACAATCG 120


9997R-3.IR_full       121 AAAAACCCAAATGAACTACAAACGACGCCGTACTGTAAGGAGCGATCACGAAATGGCTAT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9997R-3.in silico     121 AAAAACCCAAATGAACTACAAACGACGCCGTACTGTAAGGAGCGATCACGAAATGGCTAT 180


9997R-3.IR_full       181 CGATCCCAATAATCCAAATAATCCCAATAATCCAAATAATTCCGATAGTCCCGATAATCC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9997R-3.in silico     181 CGATCCCAATAATCCAAATAATCCCAATAATCCAAATAATTCCGATAGTCCCGATAATCC 240


9997R-3.IR_full       241 CAATAATCTCAATAATCCAAATAATCCGAATAATGACACAGTACAGTATGGACATTCCAA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9997R-3.in silico     241 CAATAATCTCAATAATCCAAATAATCCGAATAATGACACAGTACAGTATGGACATTCCAA 300


9997R-3.IR_full       301 GGAGCCTGTAGTTACCTTGACCAATTCGGACAAGANAGGTGCCGCTGCACGAGCTGATGG 360
                          ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
9997R-3.in silico     301 GGAGCCTGTAGTTACCTTGACCAATTCGGACAAGA-AGGTGCCGCTGCACGAGCTGATGG 360


9997R-3.IR_full       361 TGAGACTCTATCAGCAAAACAAATATATCTGCATGGGCACGGTGATATCCGAGATGCTAG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9997R-3.in silico     361 TGAGACTCTATCAGCAAAACAAATATATCTGCATGGGCACGGTGATATCCGAGATGCTAG 420


9997R-3.IR_full       421 TGATTACCACTAGCACTTGTTTTAATTTGGCCAGCAGTGATGTGGTCACGATGAAGATGT 480
                          |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
9997R-3.in silico     421 TGATTACCACTAGCACTTGTTTTAATTTGGCCAGCAGTGAAGTGGTCACGATGAAGATGT 480


9997R-3.IR_full       481 ACGATGACGAAGTCCTCGAAG 501
                          |||||||||||||||||||||
9997R-3.in silico     481 ACGATGACGAAGTCCTCGAAG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100.82  486  42  104  163  NM_143374.1  CG9997-RA (CG9997), mRNA 
0   10  NM_168850.2  CG5498-RB (CG5498), mRNA 
0   NM_176305.2  CG6416-RG, transcript variant G (CG6416), mRNA 
0   NM_135793.2  CG16970-RA (CG16970), mRNA 
0   NM_135273.4  CG5229-RA (chm), mRNA 
0   NM_131948.1  CG3081-RA (CG3081), mRNA 
0   NM_079609.2  CG6019-RA (mus308), mRNA 
0   NM_132804.1  CG9203-RA (CG9203), mRNA 
0   11  NM_176442.1  CG32937-RA (CG32937), mRNA 
0   NM_137203.2  CG8192-RA (CG8192), mRNA 
0   10  NM_139411.1  CG1919-RA (CG1919), mRNA 
0   NM_136943.1  CG8550-RA (CG8550), mRNA 
0   NM_080516.1  CG16757-RA (Spn), mRNA 
0   NM_142580.1  CG4686-RA (CG4686), mRNA 
0   18  NM_131961.1  CG2861-RA, transcript variant A (CG2861), mRNA 
0   18  NM_167021.1  CG2861-RB, transcript variant B (CG2861), mRNA 
0   11  NM_141204.3  CG1084-RA (Cont), mRNA 
0   NM_141239.1  CG17735-RA (CG17735), mRNA 
0   NM_167776.1  CG14619-RE, transcript variant E (CG14619), mRNA 
0   NM_167775.1  CG14619-RD, transcript variant D (CG14619), mRNA 
0   NM_134618.2  CG14619-RA, transcript variant A (CG14619), mRNA 
0   NM_135228.1  CG11321-RA, transcript variant A (CG11321), mRNA 
0   NM_164709.1  CG11321-RB, transcript variant B (CG11321), mRNA 
0   NM_167777.1  CG14619-RC, transcript variant C (CG14619), mRNA 
0   NM_167778.1  CG14619-RB, transcript variant B (CG14619), mRNA 
0   NM_169222.2  CG31462-RA (CG31462), mRNA 
0   18  NM_142163.1  CG3984-RA (CG3984), mRNA 
0   12  NM_078600.2  CG10521-RA (NetB), mRNA 
0   11  NM_206636.1  CG3960-RF, transcript variant F (CG3960), mRNA 
0   11  NM_139898.1  CG7409-RA (CG7409), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.