National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9972R-3 
 Symbol CG9972  Full Name CG9972 
 CG No CG9972  Old CG No CG9972 
 Synonyms CG9972 
 Accession No (Link to NCBI) NM_139496.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAAGTATTAAACGTCCGCCCCC 
 Primer Seq. 3'
aatctagaggtaccCACCGGAGGAGGTGTACAGAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AAGTATTAAA CGTCCGCCCC CCTTTAGTTG TAAACAAGTT CTTCTTACCT ATGTGATATT 
0061 AGCTTATACA GTAGCCGCCC ACAGCTCGCC CCCGCCATGT GGCCTTTATG GAGCCCCGCC 
0121 TTGCCAGTTC CTCCCGGCGC CACCTGGACA AACGCCCACC TGTGCCCGTC CAGGAAAGAC 
0181 GTACCTGCGA GCACGCCGAT AACTACCCCA CGTATCTCAT AAAGAGCCTC GTTCGAAAGT 
0241 GGGGCTATGA GGCCGCCACT CTGTTGGTGG ACGAAACCTG GGAAGATTTT GCGGCTGTGG 
0301 CGTGGCACGA TACTCCCGTC TTCTACGATC CCAAGTCCAT CTTCCCGCCC CGGGATCCCG 
0361 CTGCCCAGGA CTTTAATGGA TATAGTTATC AGACACCCTT CGGAGGTAAT CCCCAGAGAC 
0421 CGTCTGGGGG TGGAAACCCG CTCTTTGTCA GCAATCCCTC TACGGAAGCA CCCACGTATC 
0481 TTCTGTACAC CTcCTCCGGT G 
 in silico PCR Fragment
0001 AAGTATTAAA CGTCCGCCCC CCTTTAGTTG TAAACAAGTT CTTCTTACCT ATGTGATATT 
0061 AGCTTATACA GTAGCCGCCC ACAGCTCGCC CCCGCCATGT GGCCTTTATG GAGCCCCGCC 
0121 TTGCCAGTTC CTCCCGGCGC CACCTGGACA AACGCCCACC TGTGCCCGTC CAGGAAAGAC 
0181 GTA-CTGCGA GCACGCCGAT AACTACCCCA CGTATCTCAT AAAGAGCCTC GTTCGAAAGT 
0241 GGGGCTATGA GGCCGCCACT CTGTTGGTGG ACGAAACCTG GGAAGATTTT GCGGCTGTGG 
0301 CGTGGCACGA TACTCCCGTC TTCTACGATC CCAAGTCCAT CTTCCCGCCC CGGGATCCCG 
0361 CTGCCCAGGA CTTTAATGGA TATAGTTATC AGACACCCTT CGGAGGTAAT CCCCAGAGAC 
0421 CGTCTGGGGG TGGAAACCCG CTCTTTGTCA GCAATCCCTC TACGGAAGCA CCCACGTATC 
0481 TTCTGTACAC CTCCTCCGGT G 
 Assemble Data

9972R-3.IR_full       1   AAGTATTAAACGTCCGCCCCCCTTTAGTTGTAAACAAGTTCTTCTTACCTATGTGATATT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9972R-3.in silico     1   AAGTATTAAACGTCCGCCCCCCTTTAGTTGTAAACAAGTTCTTCTTACCTATGTGATATT 60


9972R-3.IR_full       61  AGCTTATACAGTAGCCGCCCACAGCTCGCCCCCGCCATGTGGCCTTTATGGAGCCCCGCC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9972R-3.in silico     61  AGCTTATACAGTAGCCGCCCACAGCTCGCCCCCGCCATGTGGCCTTTATGGAGCCCCGCC 120


9972R-3.IR_full       121 TTGCCAGTTCCTCCCGGCGCCACCTGGACAAACGCCCACCTGTGCCCGTCCAGGAAAGAC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9972R-3.in silico     121 TTGCCAGTTCCTCCCGGCGCCACCTGGACAAACGCCCACCTGTGCCCGTCCAGGAAAGAC 180


9972R-3.IR_full       181 GTACCTGCGAGCACGCCGATAACTACCCCACGTATCTCATAAAGAGCCTCGTTCGAAAGT 240
                          ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9972R-3.in silico     181 GTA-CTGCGAGCACGCCGATAACTACCCCACGTATCTCATAAAGAGCCTCGTTCGAAAGT 240


9972R-3.IR_full       241 GGGGCTATGAGGCCGCCACTCTGTTGGTGGACGAAACCTGGGAAGATTTTGCGGCTGTGG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9972R-3.in silico     241 GGGGCTATGAGGCCGCCACTCTGTTGGTGGACGAAACCTGGGAAGATTTTGCGGCTGTGG 300


9972R-3.IR_full       301 CGTGGCACGATACTCCCGTCTTCTACGATCCCAAGTCCATCTTCCCGCCCCGGGATCCCG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9972R-3.in silico     301 CGTGGCACGATACTCCCGTCTTCTACGATCCCAAGTCCATCTTCCCGCCCCGGGATCCCG 360


9972R-3.IR_full       361 CTGCCCAGGACTTTAATGGATATAGTTATCAGACACCCTTCGGAGGTAATCCCCAGAGAC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9972R-3.in silico     361 CTGCCCAGGACTTTAATGGATATAGTTATCAGACACCCTTCGGAGGTAATCCCCAGAGAC 420


9972R-3.IR_full       421 CGTCTGGGGGTGGAAACCCGCTCTTTGTCAGCAATCCCTCTACGGAAGCACCCACGTATC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9972R-3.in silico     421 CGTCTGGGGGTGGAAACCCGCTCTTTGTCAGCAATCCCTCTACGGAAGCACCCACGTATC 480


9972R-3.IR_full       481 TTCTGTACACCTCCTCCGGTG 501
                          |||||||||||||||||||||
9972R-3.in silico     481 TTCTGTACACCTCCTCCGGTG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_139496.2  CG9972-RA (CG9972), mRNA 
0   NM_137453.2  CG10914-RA (CG10914), mRNA 
0   NM_140071.2  CG3408-RA (CG3408), mRNA 
0   NM_167938.1  CG9018-RB, transcript variant B (CG9018), mRNA 
0   NM_139444.1  CG9018-RA, transcript variant A (CG9018), mRNA 
0   NM_206607.1  CG3857-RA (CG3857), mRNA 
0   NM_166129.2  CG18255-RD, transcript variant D (Strn-Mlck), mRNA 
0   NM_166125.2  CG18255-RA, transcript variant A (Strn-Mlck), mRNA 
0   NM_080110.2  CG32356-RA, transcript variant A (ImpE1), mRNA 
0   NM_132074.1  CG3585-RA (CG3585), mRNA 
0   NM_132193.1  CG1514-RA (CG1514), mRNA 
0   NM_141696.1  CG8526-RA (CG8526), mRNA 
0   NM_143409.1  CG11873-RA (CG11873), mRNA 
0   NM_079924.2  CG18780-RA (MED20), mRNA 
0   NM_131920.2  CG6379-RA (CG6379), mRNA 
0   NM_142174.1  CG6623-RA (CG6623), mRNA 
0   NM_132974.1  CG5162-RA (CG5162), mRNA 
0   NM_165019.2  CG5792-RB, transcript variant B (CG5792), mRNA 
0   NM_164599.1  CG2950-RC, transcript variant C (CG2950), mRNA 
0   NM_135022.1  CG2950-RB, transcript variant B (CG2950), mRNA 
0   NM_164598.1  CG2950-RA, transcript variant A (CG2950), mRNA 
0   NM_168787.1  CG9739-RB, transcript variant B (fz2), mRNA 
0   NM_079431.2  CG9739-RA, transcript variant A (fz2), mRNA 
0   NM_057241.2  CG7210-RB, transcript variant B (kel), mRNA 
0   NM_165242.1  CG7210-RA, transcript variant A (kel), mRNA 
0   NM_143389.2  CG14526-RA (CG14526), mRNA 
0   NM_134789.1  CG15356-RA (CG15356), mRNA 
0   NM_166666.1  CG3394-RA, transcript variant A (CG3394), mRNA 
0   NM_134490.2  CG12238-RA (l(1)G0084), mRNA 
0   NM_138062.2  CG3394-RB, transcript variant B (CG3394), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.