National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9964R-3 
 Symbol Cyp309a1  Full Name Cyp309a1 
 CG No CG9964  Old CG No CG9964 
 Synonyms 309a1, CG9964, Cyp309a1 
 Accession No (Link to NCBI) NM_134844.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
This page was unable to retrieve journal information for the resources.
Please wait a few minutes and refresh this page.
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTACTGGGATAAGCGCGGAGTG 
 Primer Seq. 3'
aatctagaggtaccGCCATCGCGTTGGCCGTAAAT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TACTGGGATA AGCGCGGAGT GGTCACCGCC GAGCCACTGA CCATTTTGGG CTCCTATCCG 
0061 GGCATTCTGA TCAACAAGAG CCGCAGTCTC ATTCTCGATG CTTCAGGATG NTCTACAATA 
0121 AATACAAGGA CAAGTACAGG ACAGTCGGAA CCTTCATTAC GCGACAGCCG CAGCTCCTGG 
0181 TTCTGGATCC CGCCCTGGCC CATGAGATTT TGGTGGACAA GTTCAGTCAC TTTCGGGACA 
0241 CCATCACCAG CAGCTTTGTG GGCCACAATC CGGATGACAA GTACGTGGCG GGGTCACCCT 
0301 NTCTTCAGCG CTGGCGACAA ATGGAAGCGA CTGCGCTCCG AAAATGTTGG CGGACTGACG 
0361 CCCAGTCGAC TGAAAATGGC CTACTCCATC TGGGAGCAGA GTGGCCGGAA GCTGGTCGAG 
0421 TATATCGAGC GGGCGCGGCG AGAACAGGGC GATATCATCG AAACCAGAGA TCTTGCCTAT 
0481 CGATTTACGG CCAACGCGAT GGC 
 in silico PCR Fragment
0001 TACTGGGATA AGCGCGGAGT GGTCACCGCC GAGCCACTGA CCATTTTGGG CTCCTATCCG 
0061 GGCATTCTGA TCAACAAGAG CCGCAGTCTC ATTCTCGATG -TTCAGGATG -TCTACAATA 
0121 AATACAAGGA CAAGTACAGG ACAGTCGGAA CCTTCATTAC GCGACAGCCG CAGCTCCTGG 
0181 TTCTGGATCC CGCCCTGGCC CATGAGATTT TGGTGGACAA GTTCAGTCAC TTTCGGGACA 
0241 CCATCACCAG CAGCTTTGTG GGCCACAATC CGGATGACAA GTACGTGGCG GGGTCACCCT 
0301 -TCTTCAGCG CTGGCGACAA ATGGAAGCGA CTGCGCTCCG AAAATGTTGG CGGACTGACG 
0361 CCCAGTCGAC TGAAAATGGC CTACTCCATC TGGGAGCAGA GTGGCCGGAA GCTGGTCGAG 
0421 TATATCGAGC GGGCGCGGCG AGAACAGGGC GATATCATCG AAACCAGAGA TCTTGCCTAT 
0481 CGATTTACGG CCAACGCGAT GGC 
 Assemble Data

9964R-3.IR_full       1   TACTGGGATAAGCGCGGAGTGGTCACCGCCGAGCCACTGACCATTTTGGGCTCCTATCCG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9964R-3.in silico     1   TACTGGGATAAGCGCGGAGTGGTCACCGCCGAGCCACTGACCATTTTGGGCTCCTATCCG 60


9964R-3.IR_full       61  GGCATTCTGATCAACAAGAGCCGCAGTCTCATTCTCGATGCTTCAGGATGNTCTACAATA 120
                          |||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||
9964R-3.in silico     61  GGCATTCTGATCAACAAGAGCCGCAGTCTCATTCTCGATG-TTCAGGATG-TCTACAATA 120


9964R-3.IR_full       121 AATACAAGGACAAGTACAGGACAGTCGGAACCTTCATTACGCGACAGCCGCAGCTCCTGG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9964R-3.in silico     121 AATACAAGGACAAGTACAGGACAGTCGGAACCTTCATTACGCGACAGCCGCAGCTCCTGG 180


9964R-3.IR_full       181 TTCTGGATCCCGCCCTGGCCCATGAGATTTTGGTGGACAAGTTCAGTCACTTTCGGGACA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9964R-3.in silico     181 TTCTGGATCCCGCCCTGGCCCATGAGATTTTGGTGGACAAGTTCAGTCACTTTCGGGACA 240


9964R-3.IR_full       241 CCATCACCAGCAGCTTTGTGGGCCACAATCCGGATGACAAGTACGTGGCGGGGTCACCCT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9964R-3.in silico     241 CCATCACCAGCAGCTTTGTGGGCCACAATCCGGATGACAAGTACGTGGCGGGGTCACCCT 300


9964R-3.IR_full        301 TCTTCAGCGCTGGCGACAAATGGAAGCGACTGCGCTCCGAAAATGTTGGCGGACTGACG 359
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9964R-3.in silico      301 TCTTCAGCGCTGGCGACAAATGGAAGCGACTGCGCTCCGAAAATGTTGGCGGACTGACG 359


9964R-3.IR_full       361 CCCAGTCGACTGAAAATGGCCTACTCCATCTGGGAGCAGAGTGGCCGGAAGCTGGTCGAG 419
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9964R-3.in silico     361 CCCAGTCGACTGAAAATGGCCTACTCCATCTGGGAGCAGAGTGGCCGGAAGCTGGTCGAG 419


9964R-3.IR_full       421 TATATCGAGCGGGCGCGGCGAGAACAGGGCGATATCATCGAAACCAGAGATCTTGCCTAT 479
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9964R-3.in silico     421 TATATCGAGCGGGCGCGGCGAGAACAGGGCGATATCATCGAAACCAGAGATCTTGCCTAT 479


9964R-3.IR_full       481 CGATTTACGGCCAACGCGATGGC 502
                          |||||||||||||||||||||||
9964R-3.in silico     481 CGATTTACGGCCAACGCGATGGC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134844.2  CG9964-RA (Cyp309a1), mRNA 
0   NM_176009.1  CG33129-RE, transcript variant E (CG33129), mRNA 
0   NM_135480.2  CG4592-RA (CG4592), mRNA 
0   21  NM_134845.1  CG18559-RA (Cyp309a2), mRNA 
0   NM_142448.2  CG8064-RA (CG8064), mRNA 
0   NM_176211.1  CG33197-RB, transcript variant B (mbl), mRNA 
0   NM_136834.1  CG13204-RA, transcript variant A (CG13204), mRNA 
0   NM_165965.1  CG3884-RA, transcript variant A (CG3884), mRNA 
0   NM_143293.2  CG14262-RA (CG14262), mRNA 
0   NM_136062.1  CG15167-RA (CG15167), mRNA 
0   10  NM_001014500.1  CG33558-RA (CG33558), mRNA 
0   NM_143398.2  CG1951-RA (CG1951), mRNA 
0   NM_168543.1  CG10724-RB, transcript variant B (CG10724), mRNA 
0   NM_140385.2  CG10724-RA, transcript variant A (CG10724), mRNA 
0   NM_135576.1  CG18302-RA (CG18302), mRNA 
0   NM_168072.1  CG15010-RA, transcript variant A (ago), mRNA 
0   NM_168073.1  CG15010-RB, transcript variant B (ago), mRNA 
0   NM_079198.2  CG15010-RC, transcript variant C (ago), mRNA 
0   14  NM_132578.1  CG11146-RA (CG11146), mRNA 
0   13  NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0   13  NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0   12  NM_135225.1  CG11323-RA (CG11323), mRNA 
0   NM_142959.2  CG6129-RB, transcript variant B (CG6129), mRNA 
0   NM_001043070.1  CG34146-RA (brp), mRNA 
0   NM_165213.2  CG5020-RB, transcript variant B (CLIP-190), mRNA 
0   NM_143265.1  CG17192-RA (CG17192), mRNA 
0   NM_135991.2  CG5020-RA, transcript variant A (CLIP-190), mRNA 
0   NM_169409.3  CG31363-RB, transcript variant B (Jupiter), mRNA 
0   NM_169404.2  CG31363-RD, transcript variant D (Jupiter), mRNA 
0   NM_169405.2  CG31363-RA, transcript variant A (Jupiter), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.