National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9964R-1 
 Symbol Cyp309a1  Full Name Cyp309a1 
 CG No CG9964  Old CG No CG9964 
 Synonyms 309a1, CG9964, Cyp309a1 
 Accession No (Link to NCBI) NM_134844.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TACTGGGATAAGCGCGGAGTGGTCACCGCCGAGCCACTGACCATTTTGGGCTCCTATCCG 60

                          |||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||| silico     61  GGCATTCTGATCAACAAGAGCCGCAGTCTCATTCTCGATG-TTCAGGATG-TCTACAATA 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AATACAAGGACAAGTACAGGACAGTCGGAACCTTCATTACGCGACAGCCGCAGCTCCTGG 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TTCTGGATCCCGCCCTGGCCCATGAGATTTTGGTGGACAAGTTCAGTCACTTTCGGGACA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CCATCACCAGCAGCTTTGTGGGCCACAATCCGGATGACAAGTACGTGGCGGGGTCACCCT 300

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico      301 TCTTCAGCGCTGGCGACAAATGGAAGCGACTGCGCTCCGAAAATGTTGGCGGACTGACG 359

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CCCAGTCGACTGAAAATGGCCTACTCCATCTGGGAGCAGAGTGGCCGGAAGCTGGTCGAG 419

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TATATCGAGCGGGCGCGGCGAGAACAGGGCGATATCATCGAAACCAGAGATCTTGCCTAT 479

9964R-1.IR_full       481 CGATTTACGGCCAACGCGATGGC 502
                          ||||||||||||||||||||||| silico     481 CGATTTACGGCCAACGCGATGGC 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134844.2  CG9964-RA (Cyp309a1), mRNA 
0   NM_176009.1  CG33129-RE, transcript variant E (CG33129), mRNA 
0   NM_135480.2  CG4592-RA (CG4592), mRNA 
0   21  NM_134845.1  CG18559-RA (Cyp309a2), mRNA 
0   NM_142448.2  CG8064-RA (CG8064), mRNA 
0   NM_176211.1  CG33197-RB, transcript variant B (mbl), mRNA 
0   NM_136834.1  CG13204-RA, transcript variant A (CG13204), mRNA 
0   NM_165965.1  CG3884-RA, transcript variant A (CG3884), mRNA 
0   NM_143293.2  CG14262-RA (CG14262), mRNA 
0   NM_136062.1  CG15167-RA (CG15167), mRNA 
0   10  NM_001014500.1  CG33558-RA (CG33558), mRNA 
0   NM_143398.2  CG1951-RA (CG1951), mRNA 
0   NM_168543.1  CG10724-RB, transcript variant B (CG10724), mRNA 
0   NM_140385.2  CG10724-RA, transcript variant A (CG10724), mRNA 
0   NM_135576.1  CG18302-RA (CG18302), mRNA 
0   NM_168072.1  CG15010-RA, transcript variant A (ago), mRNA 
0   NM_168073.1  CG15010-RB, transcript variant B (ago), mRNA 
0   NM_079198.2  CG15010-RC, transcript variant C (ago), mRNA 
0   14  NM_132578.1  CG11146-RA (CG11146), mRNA 
0   13  NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0   13  NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0   12  NM_135225.1  CG11323-RA (CG11323), mRNA 
0   NM_142959.2  CG6129-RB, transcript variant B (CG6129), mRNA 
0   NM_001043070.1  CG34146-RA (brp), mRNA 
0   NM_165213.2  CG5020-RB, transcript variant B (CLIP-190), mRNA 
0   NM_143265.1  CG17192-RA (CG17192), mRNA 
0   NM_135991.2  CG5020-RA, transcript variant A (CLIP-190), mRNA 
0   NM_169409.3  CG31363-RB, transcript variant B (Jupiter), mRNA 
0   NM_169404.2  CG31363-RD, transcript variant D (Jupiter), mRNA 
0   NM_169405.2  CG31363-RA, transcript variant A (Jupiter), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.