National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9962R-2 
 Symbol CG9962  Full Name CG9962 
 CG No CG9962  Old CG No CG9962 
 Synonyms CG9962 
 Accession No (Link to NCBI) NM_134853.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGAGACATCTACGAGGCCAAG 
 Primer Seq. 3'
aatctagaggtaccCAACAAAGGGCGTTAACGGAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGAGACATCT ACGAGGCCAA GCACATGGGG TCAGGACTCC ACGTAGCCCT CAAGGTGGAG 
0061 CGCAAAAATG CCGGCCAATC GCACTTGAGC ATCGAGTCCA CGGTGTACAA TCTGCTGAGA 
0121 CATGGTATGG GAATCCCGAT GACGTACCAG TTCTTCTCAA ACAGGCGGCA CGACGTGCTG 
0181 GTCATGGAGT TACTGGGCCC CTCGTTGGAG ACGCTATTCA CGATGTGTAA TCGCCGCTTC 
0241 TCCATGAAGA CTGTACTCAT GCTGGCTGAC CAGATGGTGG ACCGTTTGGA GTACCTGCAC 
0301 CTCCATCACT ACGTGCACCG CGACATTAAG CCGGAAAACT TCCTGATGGG CGTTGGCCTG 
0361 ACCAGACACC GGCTCCACCT CATCGACTTC GGCCTATCCA AGCGGTACTG GGACATGAAG 
0421 GAGAACAGGC ATGTGCCACA AAGGCGCGGC ACAAAGTGGG GCCGGCACCG NCCGCTACGC 
0481 CTTCCGTTAA CGCCCTTTTG TTG 
 in silico PCR Fragment
0001 GGAGACATCT ACGAGGCCAA GCACATGGGG TCAGGACTCC ACGTAGCCCT CAAGGTGGAG 
0061 CGCAAAAATG CCGGCCAATC GCACTTGAGC ATCGAGTCCA CGGTGTACAA TCTGCTGAGA 
0121 CATGGTATGG GAATCCCGAT GACGTACCAG TTTTTCTCAA ACAGGCGGCA CGACGTGCTG 
0181 GTCATGGAGT TACTGGGCCC CTCGTTGGAG ACGCTATTCA CGATGTGTAA TCGCCGCTTC 
0241 TCCATGAAGA CTGTACTCAT GCTGGCTGAC CAGATGGTGG ACCGTTTGGA GTACCTGCAC 
0301 CTCCATCACT ACGTGCACCG CGACATTAAG CCGGAAAACT TTCTGATGGG CGTTGGCCTG 
0361 ACCAGACACC GGCTCCACCT CATCGACTTC GGCCTATCCA AGCGGTACTG GGACATGAAG 
0421 GAGAACAGGC ATGTGCCACA AAGGCGCGGC ACAAAGT-GG GCCGGCACCG CCCGCTACGC 
0481 C-TCCGTTAA CGCCC-TTTG TTG 
 Assemble Data

9962R-2.IR_full       1   GGAGACATCTACGAGGCCAAGCACATGGGGTCAGGACTCCACGTAGCCCTCAAGGTGGAG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9962R-2.in silico     1   GGAGACATCTACGAGGCCAAGCACATGGGGTCAGGACTCCACGTAGCCCTCAAGGTGGAG 60


9962R-2.IR_full       61  CGCAAAAATGCCGGCCAATCGCACTTGAGCATCGAGTCCACGGTGTACAATCTGCTGAGA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9962R-2.in silico     61  CGCAAAAATGCCGGCCAATCGCACTTGAGCATCGAGTCCACGGTGTACAATCTGCTGAGA 120


9962R-2.IR_full       121 CATGGTATGGGAATCCCGATGACGTACCAGTTCTTCTCAAACAGGCGGCACGACGTGCTG 180
                          |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
9962R-2.in silico     121 CATGGTATGGGAATCCCGATGACGTACCAGTTTTTCTCAAACAGGCGGCACGACGTGCTG 180


9962R-2.IR_full       181 GTCATGGAGTTACTGGGCCCCTCGTTGGAGACGCTATTCACGATGTGTAATCGCCGCTTC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9962R-2.in silico     181 GTCATGGAGTTACTGGGCCCCTCGTTGGAGACGCTATTCACGATGTGTAATCGCCGCTTC 240


9962R-2.IR_full       241 TCCATGAAGACTGTACTCATGCTGGCTGACCAGATGGTGGACCGTTTGGAGTACCTGCAC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9962R-2.in silico     241 TCCATGAAGACTGTACTCATGCTGGCTGACCAGATGGTGGACCGTTTGGAGTACCTGCAC 300


9962R-2.IR_full       301 CTCCATCACTACGTGCACCGCGACATTAAGCCGGAAAACTTCCTGATGGGCGTTGGCCTG 360
                          ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
9962R-2.in silico     301 CTCCATCACTACGTGCACCGCGACATTAAGCCGGAAAACTTTCTGATGGGCGTTGGCCTG 360


9962R-2.IR_full       361 ACCAGACACCGGCTCCACCTCATCGACTTCGGCCTATCCAAGCGGTACTGGGACATGAAG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9962R-2.in silico     361 ACCAGACACCGGCTCCACCTCATCGACTTCGGCCTATCCAAGCGGTACTGGGACATGAAG 420


9962R-2.IR_full       421 GAGAACAGGCATGTGCCACAAAGGCGCGGCACAAAGTGGGGCCGGCACCGNCCGCTACGC 480
                          ||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||
9962R-2.in silico     421 GAGAACAGGCATGTGCCACAAAGGCGCGGCACAAAGT-GGGCCGGCACCGCCCGCTACGC 480


9962R-2.IR_full       481 CTTCCGTTAACGCCCTTTTGTTG 503
                          | ||||||||||||| |||||||
9962R-2.in silico     481 C-TCCGTTAACGCCC-TTTGTTG 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134853.1  CG9962-RA (CG9962), mRNA 
0.2   NM_142670.2  CG5621-RA, transcript variant A (CG5621), mRNA 
0.2   NM_001043270.1  CG5621-RB, transcript variant B (CG5621), mRNA 
0   NM_142577.1  CG4583-RA (ire-1), mRNA 
0   21  15  NM_132566.1  CG2577-RA (CG2577), mRNA 
0   NM_058089.3  CG6213-RA (Vha13), mRNA 
0   11  NM_135106.1  CG7236-RA (CG7236), mRNA 
0   NM_136103.2  CG10563-RA (CG10563), mRNA 
0   NM_135755.1  CG9932-RA (CG9932), mRNA 
0   NM_166761.1  CG1495-RC, transcript variant C (CaMKI), mRNA 
0   NM_166760.1  CG1495-RB, transcript variant B (CaMKI), mRNA 
0   NM_166759.1  CG1495-RA, transcript variant A (CaMKI), mRNA 
0   NM_166762.1  CG1495-RE, transcript variant E (CaMKI), mRNA 
0   NM_079883.2  CG1495-RG, transcript variant G (CaMKI), mRNA 
0   NM_166763.1  CG1495-RD, transcript variant D (CaMKI), mRNA 
0   NM_166764.1  CG1495-RH, transcript variant H (CaMKI), mRNA 
0   NM_170379.2  CG31048-RA (CG31048), mRNA 
0   NM_166559.1  CG3622-RA, transcript variant A (CG3622), mRNA 
0   NM_137874.2  CG3622-RB, transcript variant B (CG3622), mRNA 
0   NM_138124.2  CG3589-RA (CG3589), mRNA 
0   NM_079572.2  CG9484-RA (hyd), mRNA 
0   13  20  NM_142487.1  CG7709-RA (CG7709), mRNA 
0   12  16  NM_141279.2  CG12147-RA (CG12147), mRNA 
0   11  36  NM_170536.2  CG2048-RB, transcript variant B (dco), mRNA 
0   11  36  NM_079863.2  CG2048-RC, transcript variant C (dco), mRNA 
0   11  36  NM_170535.1  CG2048-RA, transcript variant A (dco), mRNA 
0   11  21  NM_167331.1  CG2028-RA, transcript variant A (CkIalpha), mRNA 
0   11  21  NM_167332.1  CG2028-RC, transcript variant C (CkIalpha), mRNA 
0   11  21  NM_078585.3  CG2028-RB, transcript variant B (CkIalpha), mRNA 
0   NM_169924.1  CG31421-RA (Takl1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.