National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9962R-1 
 Symbol CG9962  Full Name CG9962 
 CG No CG9962  Old CG No CG9962 
 Synonyms CG9962 
 Accession No (Link to NCBI) NM_134853.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GGAGACATCTACGAGGCCAAGCACATGGGGTCAGGACTCCACGTAGCCCTCAAGGTGGAG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CGCAAAAATGCCGGCCAATCGCACTTGAGCATCGAGTCCACGGTGTACAATCTGCTGAGA 120

                          |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| silico     121 CATGGTATGGGAATCCCGATGACGTACCAGTTTTTCTCAAACAGGCGGCACGACGTGCTG 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GTCATGGAGTTACTGGGCCCCTCGTTGGAGACGCTATTCACGATGTGTAATCGCCGCTTC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TCCATGAAGACTGTACTCATGCTGGCTGACCAGATGGTGGACCGTTTGGAGTACCTGCAC 300

                          ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| silico     301 CTCCATCACTACGTGCACCGCGACATTAAGCCGGAAAACTTTCTGATGGGCGTTGGCCTG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 ACCAGACACCGGCTCCACCTCATCGACTTCGGCCTATCCAAGCGGTACTGGGACATGAAG 420

                          ||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||| silico     421 GAGAACAGGCATGTGCCACAAAGGCGCGGCACAAAGT-GGGCCGGCACCGCCCGCTACGC 480

9962R-1.IR_full       481 CTTCCGTTAACGCCCTTTTGTTG 503
                          | ||||||||||||| ||||||| silico     481 C-TCCGTTAACGCCC-TTTGTTG 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134853.1  CG9962-RA (CG9962), mRNA 
0.2   NM_142670.2  CG5621-RA, transcript variant A (CG5621), mRNA 
0.2   NM_001043270.1  CG5621-RB, transcript variant B (CG5621), mRNA 
0   NM_142577.1  CG4583-RA (ire-1), mRNA 
0   21  15  NM_132566.1  CG2577-RA (CG2577), mRNA 
0   NM_058089.3  CG6213-RA (Vha13), mRNA 
0   11  NM_135106.1  CG7236-RA (CG7236), mRNA 
0   NM_136103.2  CG10563-RA (CG10563), mRNA 
0   NM_135755.1  CG9932-RA (CG9932), mRNA 
0   NM_166761.1  CG1495-RC, transcript variant C (CaMKI), mRNA 
0   NM_166760.1  CG1495-RB, transcript variant B (CaMKI), mRNA 
0   NM_166759.1  CG1495-RA, transcript variant A (CaMKI), mRNA 
0   NM_166762.1  CG1495-RE, transcript variant E (CaMKI), mRNA 
0   NM_079883.2  CG1495-RG, transcript variant G (CaMKI), mRNA 
0   NM_166763.1  CG1495-RD, transcript variant D (CaMKI), mRNA 
0   NM_166764.1  CG1495-RH, transcript variant H (CaMKI), mRNA 
0   NM_170379.2  CG31048-RA (CG31048), mRNA 
0   NM_166559.1  CG3622-RA, transcript variant A (CG3622), mRNA 
0   NM_137874.2  CG3622-RB, transcript variant B (CG3622), mRNA 
0   NM_138124.2  CG3589-RA (CG3589), mRNA 
0   NM_079572.2  CG9484-RA (hyd), mRNA 
0   13  20  NM_142487.1  CG7709-RA (CG7709), mRNA 
0   12  16  NM_141279.2  CG12147-RA (CG12147), mRNA 
0   11  36  NM_170536.2  CG2048-RB, transcript variant B (dco), mRNA 
0   11  36  NM_079863.2  CG2048-RC, transcript variant C (dco), mRNA 
0   11  36  NM_170535.1  CG2048-RA, transcript variant A (dco), mRNA 
0   11  21  NM_167331.1  CG2028-RA, transcript variant A (CkIalpha), mRNA 
0   11  21  NM_167332.1  CG2028-RC, transcript variant C (CkIalpha), mRNA 
0   11  21  NM_078585.3  CG2028-RB, transcript variant B (CkIalpha), mRNA 
0   NM_169924.1  CG31421-RA (Takl1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.