National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9940R-2 
 Symbol CG9940  Full Name CG9940 
 CG No CG9940  Old CG No CG9940 
 Synonyms 145027_at, Q9VYA0, CG9940 
 Accession No (Link to NCBI) NM_132685.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGTAGCGGTGTCCACATTGAA 
 Primer Seq. 3'
aatctagaggtaccCGTAGCCCAAACAGGTATCCC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGTaGCGGTg tcCACATTGA ATCAATGGGC ATTGGACTTT GAGGGTAACA TGGTGAGGAT 
0061 ACTGCAGTCC ATTCTGGAGG CCAAGGACAT GGGCGCTCAg cTATCNGCAC GGGACCGGAG 
0121 CTGGAAGTTT GTGGCTACAG CTGCGAGGAT CCACTTTCGT GAGCCGGACA CATTCCTGCA 
0181 CTCGTGGGAA GTGCTGCTGG AGGTGATGAT GTCGCCCATG TGTGAAAATA TGCTGGTGGA 
0241 CGTNNNGCAT GCCGGTGATG CATCGCAATG TGGCCTACAA TTGTCGGGTG GCGTTCTTTA 
0301 ATCGCCCAGA TTCTGCTCAT CCGGCCCAAG ATGGCCATGT GCGACGATGG CAATTATAGG 
0361 GAGTCGCGAT GGTTTACCGC CTGGACGAAA GCCCTACAAA CGGAGGAGTA tgTGNTGCCG 
0421 CGAATGATTG CCCAGCATAC GGGTCAGCAG ACGGTTCCCT TTgGNGATGC AGTGATAGCC 
0481 ACGAGGGATA CCTGTTTGGG CTACG 
 in silico PCR Fragment
0001 CGTAGCGGTG TCCACATTGA ATCAATGGGC ATTGGACTTT GAGGGTAACA TGGTGAGGAT 
0061 ACTGCAGTCC ATTCTGGAGG CCAAGGACAT GGGCGC-CAG CTATC-GCAC GGGACCGGAG 
0121 CTGGAAGTTT GTGGCTACAG CTGCGAGGA- CCACTTTCGT GAGCCGGACA CATTCCTGCA 
0181 CTCGTGGGAA GTGCTGCTGG AGGTGATGAT GTCGCCCATG TGTGAAAATA TGCTGGTGGA 
0241 CGT-GGGCAT GCCGGTGATG CATCGCAATG TGGCCTACAA TTGTCGGGTG GCGTTCTTTA 
0301 ATCG-CCAGA TTCTGCTCAT CCGGCCCAAG ATGGCCATGT GCGACGATGG CAATTATAGG 
0361 GAGTCGCGAT GGTTTACCGC CTGGACGAAA GCCCTACAAA CGGAGGAGTA TGTGCTGCCG 
0421 CGAATGATTG CCCAGCATAC GGGTCAGCAG ACGGTTCCCT TTGGCGATGC AGTGATAGCC 
0481 ACGAGGGATA CCTGTTTGGG CTACG 
 Assemble Data

9940R-2.IR_full       1   CGTAGCGGTGTCCACATTGAATCAATGGGCATTGGACTTTGAGGGTAACATGGTGAGGAT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9940R-2.in silico     1   CGTAGCGGTGTCCACATTGAATCAATGGGCATTGGACTTTGAGGGTAACATGGTGAGGAT 60


9940R-2.IR_full       61  ACTGCAGTCCATTCTGGAGGCCAAGGACATGGGCGCTCAGCTATCNGCACGGGACCGGAG 120
                          |||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||
9940R-2.in silico     61  ACTGCAGTCCATTCTGGAGGCCAAGGACATGGGCGC-CAGCTATC-GCACGGGACCGGAG 120


9940R-2.IR_full       121 CTGGAAGTTTGTGGCTACAGCTGCGAGGATCCACTTTCGTGAGCCGGACACATTCCTGCA 180
                          ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
9940R-2.in silico     121 CTGGAAGTTTGTGGCTACAGCTGCGAGGA-CCACTTTCGTGAGCCGGACACATTCCTGCA 180


9940R-2.IR_full       181 CTCGTGGGAAGTGCTGCTGGAGGTGATGATGTCGCCCATGTGTGAAAATATGCTGGTGGA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9940R-2.in silico     181 CTCGTGGGAAGTGCTGCTGGAGGTGATGATGTCGCCCATGTGTGAAAATATGCTGGTGGA 240


9940R-2.IR_full       241 CGTNNNGCATGCCGGTGATGCATCGCAATGTGGCCTACAATTGTCGGGTGGCGTTCTTTA 300
                          |||   ||||||||||||||||||||||||||||||||||||||||||||||||||||||
9940R-2.in silico     241 CGT-GGGCATGCCGGTGATGCATCGCAATGTGGCCTACAATTGTCGGGTGGCGTTCTTTA 300


9940R-2.IR_full       301 ATCGCCCAGATTCTGCTCATCCGGCCCAAGATGGCCATGTGCGACGATGGCAATTATAGG 360
                          |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
9940R-2.in silico     301 ATCG-CCAGATTCTGCTCATCCGGCCCAAGATGGCCATGTGCGACGATGGCAATTATAGG 360


9940R-2.IR_full       361 GAGTCGCGATGGTTTACCGCCTGGACGAAAGCCCTACAAACGGAGGAGTATGTGNTGCCG 420
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
9940R-2.in silico     361 GAGTCGCGATGGTTTACCGCCTGGACGAAAGCCCTACAAACGGAGGAGTATGTGCTGCCG 420


9940R-2.IR_full       421 CGAATGATTGCCCAGCATACGGGTCAGCAGACGGTTCCCTTTGGNGATGCAGTGATAGCC 480
                          |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||
9940R-2.in silico     421 CGAATGATTGCCCAGCATACGGGTCAGCAGACGGTTCCCTTTGGCGATGCAGTGATAGCC 480


9940R-2.IR_full       481 ACGAGGGATACCTGTTTGGGCTACG 505
                          |||||||||||||||||||||||||
9940R-2.in silico     481 ACGAGGGATACCTGTTTGGGCTACG 505

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_167378.1  CG9940-RB, transcript variant B (CG9940), mRNA 
100   482  NM_132685.1  CG9940-RA, transcript variant A (CG9940), mRNA 
0   NM_001014745.1  CG9210-RB, transcript variant B (Ac13E), mRNA 
0   NM_057951.2  CG9210-RA, transcript variant A (Ac13E), mRNA 
0   NR_002696.1  CR33987, miscRNA 
0   NM_142817.1  CG17622-RA (CG17622), mRNA 
0   NM_001043105.1  CG3441-RB, transcript variant B (Nplp1), mRNA 
0   NM_138149.2  CG3441-RA, transcript variant A (Nplp1), mRNA 
0   NM_131983.2  CG17764-RA (CG17764), mRNA 
0   NM_079478.3  CG5069-RA (croc), mRNA 
0   NM_057539.3  CG9310-RA, transcript variant A (Hnf4), mRNA 
0   NM_164833.1  CG9310-RB, transcript variant B (Hnf4), mRNA 
0   NM_164834.1  CG9310-RC, transcript variant C (Hnf4), mRNA 
0   NM_169932.1  CG31223-RA (CG31223), mRNA 
0   NM_165853.1  CG13188-RA, transcript variant A (CG13188), mRNA 
0   NM_057651.2  CG8224-RB, transcript variant B (babo), mRNA 
0   NM_057652.2  CG8224-RA, transcript variant A (babo), mRNA 
0   NM_135412.1  CG9487-RA (CG9487), mRNA 
0   NM_134927.1  CG15412-RA (CG15412), mRNA 
0   NM_167923.1  CG13937-RB, transcript variant B (CG13937), mRNA 
0   10  NM_132412.1  CG9817-RA (CG9817), mRNA 
0   NM_057744.2  CG1708-RA (cos), mRNA 
0   NM_136178.2  CG10747-RA (CG10747), mRNA 
0   NM_137288.2  CG4439-RA (CG4439), mRNA 
0   10  NM_079172.2  CG11494-RB, transcript variant B (BtbVII), mRNA 
0   10  NM_167990.1  CG11494-RA, transcript variant A (BtbVII), mRNA 
0   NM_165277.1  CG10699-RB, transcript variant B (Lim3), mRNA 
0   NM_140544.1  CG7554-RA (comm2), mRNA 
0   10  NM_057516.3  CG5403-RA, transcript variant A (retn), mRNA 
0   10  NM_176254.1  CG5403-RB, transcript variant B (retn), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.