National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock temporarily unavailable request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9938R-2 
 Symbol CG9938  Full Name CG9938 
 CG No CG9938  Old CG No CG9938 
 Synonyms CG9938, dmNdc80 
 Accession No (Link to NCBI) NM_132674.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCACCGGTTTGTGCCCTCCACT 
 Primer Seq. 3'
aatctagaggtaccATGATGGTCGTCGACTCGCAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CACCGGTTTG TGCCCTCCAC TGCGCGAgNG CGCCATTGCG CCACACTCCG ACAAGAAATG 
0061 GGTGGCGGAG AGGGCACAGC AGATCCTGGA ATACCTACAT GGCATTCAGA NACAGCGAGG 
0121 CGCCCACTGG ACTTATTGCG GATCTATTCA GTCGGCCCGG GGGTTTGCGA CACATGACCA 
0181 TCAAGCAATT TGTTTCCATT CTCAACTTTA TGTTCCACCA CATCTGGCGA AATCGCGTGA 
0241 CAGTGGGCCA GAACCATGTC GAGGATATTA CCAGCGCAAT GCAAAAGCTA CAGTATCCTT 
0301 ATCAGGTGAA CAAATCATGG CTTGTATCGC CAACAACACA GCATTCATTC GGCCATGTGA 
0361 TCGTTCTGCT GGACTTTCTC ATGGACTTTT TACCGCCTCT GCCCTCGTCG GATGTGGTGG 
0421 AGGAGGAGTT TCCGTTTATG GAAACCATGG AGCAGCCCAG CTCGTATCTG AATAGCATGC 
0481 ACTGCGAGTC GACGACCATC AT 
 in silico PCR Fragment
0001 CACCGGTTTG TGCCCTCCAC TGCG-GAGCG CGCCATTGCG CCACACTCCG ACAAGAAATG 
0061 GGTGGCGGAG AGGGCACAGC AGATCCTGGA ATACCTACAT GGCATTCAGA -ACAGCGAGG 
0121 CGCCCACTGG ACTTATTGCG GATCTATTCA GTCGGCCCGG GGGTTTGCGA CACATGACCA 
0181 TCAAGCAATT TGTTTCCATT CTCAACTTTA TGTTCCACCA CATCTGGCGA AATCGCGTGA 
0241 CAGTGGGCCA GAACCATGTC GAGGATATTA CCAGCGCAAT GCAAAAGCTA CAGTATCCTT 
0301 ATCAGGTGAA CAAATCATGG CTTGTATCGC CAACAACACA GCATTCATTC GGCCATGTGA 
0361 TCGTTCTGCT GGACTTTCTC ATGGACTTTT TACCGCCTCT GCCCTCGTCG GATGTGGTGG 
0421 AGGAGGAGTT TCCGTTTATG GAAACCATGG AGCAGCCCAG CTCGTATCTG AATAGCATGC 
0481 ACTGCGAGTC GACGACCATC AT 
 Assemble Data

9938R-2.IR_full       1   CACCGGTTTGTGCCCTCCACTGCGCGAGNGCGCCATTGCGCCACACTCCGACAAGAAATG 60
                          |||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||
9938R-2.in silico     1   CACCGGTTTGTGCCCTCCACTGCG-GAGCGCGCCATTGCGCCACACTCCGACAAGAAATG 60


9938R-2.IR_full       61  GGTGGCGGAGAGGGCACAGCAGATCCTGGAATACCTACATGGCATTCAGANACAGCGAGG 120
                          |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
9938R-2.in silico     61  GGTGGCGGAGAGGGCACAGCAGATCCTGGAATACCTACATGGCATTCAGA-ACAGCGAGG 120


9938R-2.IR_full       121 CGCCCACTGGACTTATTGCGGATCTATTCAGTCGGCCCGGGGGTTTGCGACACATGACCA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9938R-2.in silico     121 CGCCCACTGGACTTATTGCGGATCTATTCAGTCGGCCCGGGGGTTTGCGACACATGACCA 180


9938R-2.IR_full       181 TCAAGCAATTTGTTTCCATTCTCAACTTTATGTTCCACCACATCTGGCGAAATCGCGTGA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9938R-2.in silico     181 TCAAGCAATTTGTTTCCATTCTCAACTTTATGTTCCACCACATCTGGCGAAATCGCGTGA 240


9938R-2.IR_full       241 CAGTGGGCCAGAACCATGTCGAGGATATTACCAGCGCAATGCAAAAGCTACAGTATCCTT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9938R-2.in silico     241 CAGTGGGCCAGAACCATGTCGAGGATATTACCAGCGCAATGCAAAAGCTACAGTATCCTT 300


9938R-2.IR_full       301 ATCAGGTGAACAAATCATGGCTTGTATCGCCAACAACACAGCATTCATTCGGCCATGTGA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9938R-2.in silico     301 ATCAGGTGAACAAATCATGGCTTGTATCGCCAACAACACAGCATTCATTCGGCCATGTGA 360


9938R-2.IR_full       361 TCGTTCTGCTGGACTTTCTCATGGACTTTTTACCGCCTCTGCCCTCGTCGGATGTGGTGG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9938R-2.in silico     361 TCGTTCTGCTGGACTTTCTCATGGACTTTTTACCGCCTCTGCCCTCGTCGGATGTGGTGG 420


9938R-2.IR_full       421 AGGAGGAGTTTCCGTTTATGGAAACCATGGAGCAGCCCAGCTCGTATCTGAATAGCATGC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9938R-2.in silico     421 AGGAGGAGTTTCCGTTTATGGAAACCATGGAGCAGCCCAGCTCGTATCTGAATAGCATGC 480


9938R-2.IR_full       481 ACTGCGAGTCGACGACCATCAT 502
                          ||||||||||||||||||||||
9938R-2.in silico     481 ACTGCGAGTCGACGACCATCAT 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_132674.2  CG9938-RA (CG9938), mRNA 
0   NM_135689.2  CG12264-RA (CG12264), mRNA 
0   NM_137065.1  CG30484-RA (CG30484), mRNA 
0   NM_170063.2  CG10868-RD, transcript variant D (orb), mRNA 
0   NM_170062.1  CG10868-RB, transcript variant B (orb), mRNA 
0   NM_079736.2  CG10868-RA, transcript variant A (orb), mRNA 
0   NM_206172.1  CG8201-RG, transcript variant G (par-1), mRNA 
0   NM_206175.2  CG8201-RF, transcript variant F (par-1), mRNA 
0   NM_206176.2  CG8201-RD, transcript variant D (par-1), mRNA 
0   NM_206174.2  CG8201-RE, transcript variant E (par-1), mRNA 
0   NM_206173.2  CG8201-RC, transcript variant C (par-1), mRNA 
0   NM_001014541.1  CG8201-RM, transcript variant M (par-1), mRNA 
0   NM_135239.1  CG18304-RA (CG18304), mRNA 
0   NM_142891.1  CG17382-RA (CG17382), mRNA 
0   NM_001043113.1  CG33484-RC, transcript variant C (zormin), mRNA 
0   NM_206240.1  CG33484-RA, transcript variant A (zormin), mRNA 
0   NM_001043112.1  CG33484-RB, transcript variant B (zormin), mRNA 
0   NM_001043114.1  CG33484-RD, transcript variant D (zormin), mRNA 
0   NM_135162.1  CG13983-RA (CG13983), mRNA 
0   NM_132311.2  CG12119-RA (CG12119), mRNA 
0   NM_078601.2  CG9533-RA (rut), mRNA 
0   NM_132587.2  CG11085-RA (CG11085), mRNA 
0   NM_164638.1  CG14025-RC, transcript variant C (Bsg25D), mRNA 
0   NM_057568.4  CG14025-RA, transcript variant A (Bsg25D), mRNA 
0   NM_130546.2  CG11409-RB (CG11409), mRNA 
0   NM_164637.1  CG14025-RB, transcript variant B (Bsg25D), mRNA 
0   NM_078862.2  CG17914-RA (yellow-b), mRNA 
0   NM_137671.1  CG15226-RA (CG15226), mRNA 
0   NM_170070.1  CG17077-RC, transcript variant C (pnt), mRNA 
0   NM_001042968.1  CG40127-RA (CG40127), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.