National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9924R-2 
 Symbol rdx  Full Name roadkill 
 CG No CG12537  Old CG No CG9924 
 Synonyms rdx, CG9924, hib, CG10235, CG12537, BEST:GM07940, anon-WO0118547.577 
 Accession No (Link to NCBI) NM_169565.1 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TTGCCGAGAACTGGTGCTACACGCAGGTCAAAGTGGTTAAATTTAGTTATATGTGGACCA 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TAAATAACTTTAGTTTTTGTCGGGAAGAAATGGGTGAGGTACTCAAATCGTCCACATTCT 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CAGCCGGTGCTAATGACAAACTAAAATGGTGTTTACGGGTTAACCCCAAGGGTCTCGACG 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 AGGAGAGCAAGGATTACCTTTCTTTATATTTACTGTTAGTTTCGTGTAATAAATCAGAAG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TCAGAGCCAAGTTCAAATTTTCCATACTGAATGCGAAGCGTGAGGAAACCAAAGCAATGG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AATCCCAAAGAGCTTATCGTTTTGTGCAGGGCAAAGATTGGGGCTTCAAGAAGTTCATCC 360

                          |||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| silico     361 GACGAGACTTCCTGCTGG-ACGAGGCCAACGGCCTGCTGCCGGAGGATAAGCTGACCATC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TTCTGCGAGGTCAGCGTCGTGGCGGACAGCGTGAACATCTCCGGACAATCCAATATCGTG 480

9924R-2.IR_full       481 CAGTTCAAAGTGCCCGAATGC 501
                          ||||||||||||||||||||| silico     481 CAGTTCAAAGTGCCCGAATGC 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_169566.1  CG9924-RB, transcript variant B (CG9924), mRNA 
100   482  NM_142068.1  CG9924-RC, transcript variant C (CG9924), mRNA 
100   482  NM_169564.1  CG9924-RD, transcript variant D (CG9924), mRNA 
100   482  NM_001038965.1  CG9924-RE, transcript variant E (CG9924), mRNA 
100   482  NM_169565.1  CG9924-RA, transcript variant A (CG9924), mRNA 
0   NM_137455.4  CG10915-RA (CG10915), mRNA 
0   NM_169576.1  CG31321-RB (CG31321), mRNA 
0   NM_001043110.1  CG6883-RB, transcript variant B (trh), mRNA 
0   NM_079148.2  CG6883-RA, transcript variant A (trh), mRNA 
0   NM_132184.1  CG15327-RA (CG15327), mRNA 
0   NM_137169.3  CG11798-RA, transcript variant A (chn), mRNA 
0   NM_206119.1  CG11798-RB, transcript variant B (chn), mRNA 
0   NM_001043082.1  CG11798-RC, transcript variant C (chn), mRNA 
0   NM_079503.2  CG9761-RA (Nep2), mRNA 
0   NM_142809.2  CG6937-RA (CG6937), mRNA 
0   NM_170026.1  CG5264-RA (btn), mRNA 
0   NM_134496.2  CG14215-RA (CG14215), mRNA 
0   NM_080301.2  CG3848-RC, transcript variant C (trr), mRNA 
0   NM_166911.3  CG3848-RD, transcript variant D (trr), mRNA 
0   NM_140636.2  CG4672-RA (TMS1), mRNA 
0   NM_206227.1  CG12038-RA, transcript variant A (CG12038), mRNA 
0   NM_206226.1  CG12038-RB, transcript variant B (CG12038), mRNA 
0   NM_136693.2  CG12130-RA (CG12130), mRNA 
0   NM_057384.3  CG3956-RA (sna), mRNA 
0   NM_079845.2  CG7951-RA (sima), mRNA 
0   NM_080335.2  CG2984-RA (Pp2C1), mRNA 
0   NM_141829.2  CG14709-RA (CG14709), mRNA 
0   NM_137492.1  CG17669-RA (CG17669), mRNA 
0   NM_132519.1  CG9369-RA (m), mRNA 
0   NM_138115.2  CG30421-RA (CG30421), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.