National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9924R-1 
 Symbol rdx  Full Name roadkill 
 CG No CG12537  Old CG No CG9924 
 Synonyms rdx, CG9924, hib, CG10235, CG12537, BEST:GM07940, anon-WO0118547.577 
 Accession No (Link to NCBI) NM_169565.1 
 Inserted Chr. ll 
 Insertional Mutation  3 lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Pan C, Xiong Y, Lv X, Xia Y, Zhang S, Chen H, Fan J, Wu W, Liu F, Wu H, Zhou Z, Zhang L, Zhao Y.
UbcD1 regulates Hedgehog signaling by directly modulating Ci ubiquitination and processing.
EMBO Rep. (2017) 18(11) 1922-1934 [ PubMed ID = 28887318 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTGCCGAGAACTGGTGCTACA 
 Primer Seq. 3'
aatctagaggtaccGCATTCGGGCACTTTGAACTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TTGCCGAGAA CTGGTGCTAC ACGCAGGTCA AAGTGGTTAA ATTTAGTTAT ATGTGGACCA 
0061 TAAATAACTT TAGTTTTTGT CGGGAAGAAA TGGGTGAGGT ACTCAAATCG TCCACATTCT 
0121 CAGCCGGTGC TAATGACAAA CTAAAATGGT GTTTACGGGT TAACCCCAAG GGTCTCGACG 
0181 AGGAGAGCAA GGATTACCTT TCTTTATATT TACTGTTAGT TTCGTGTAAT AAATCAGAAG 
0241 TCAGAGCCAA GTTCAAATTT TCCATACTGA ATGCGAAGCG TGAGGAAACC AAAGCAATGG 
0301 AATCCCAAAG AGCTTATCGT TTTGTGCAGG GCAAAGATTG GGGCTTCAAG AAGTTCATCC 
0361 GACGAGACTT CCTGCTGGAA CGAGGCCAAC NGCCTGCTGC CGGAGGATAA GCTGACCATC 
0421 TTCTGCGAGG TCAGCGTCGT GGCGGACAGC GTGAACATCT CCGGACAATC CAATATCGTG 
0481 CAGTTCAAAG TGCCCGAATG C 
 in silico PCR Fragment
0001 TTGCCGAGAA CTGGTGCTAC ACGCAGGTCA AAGTGGTTAA ATTTAGTTAT ATGTGGACCA 
0061 TAAATAACTT TAGTTTTTGT CGGGAAGAAA TGGGTGAGGT ACTCAAATCG TCCACATTCT 
0121 CAGCCGGTGC TAATGACAAA CTAAAATGGT GTTTACGGGT TAACCCCAAG GGTCTCGACG 
0181 AGGAGAGCAA GGATTACCTT TCTTTATATT TACTGTTAGT TTCGTGTAAT AAATCAGAAG 
0241 TCAGAGCCAA GTTCAAATTT TCCATACTGA ATGCGAAGCG TGAGGAAACC AAAGCAATGG 
0301 AATCCCAAAG AGCTTATCGT TTTGTGCAGG GCAAAGATTG GGGCTTCAAG AAGTTCATCC 
0361 GACGAGACTT CCTGCTGG-A CGAGGCCAAC GGCCTGCTGC CGGAGGATAA GCTGACCATC 
0421 TTCTGCGAGG TCAGCGTCGT GGCGGACAGC GTGAACATCT CCGGACAATC CAATATCGTG 
0481 CAGTTCAAAG TGCCCGAATG C 
 Assemble Data

9924R-1.IR_full       1   TTGCCGAGAACTGGTGCTACACGCAGGTCAAAGTGGTTAAATTTAGTTATATGTGGACCA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9924R-1.in silico     1   TTGCCGAGAACTGGTGCTACACGCAGGTCAAAGTGGTTAAATTTAGTTATATGTGGACCA 60


9924R-1.IR_full       61  TAAATAACTTTAGTTTTTGTCGGGAAGAAATGGGTGAGGTACTCAAATCGTCCACATTCT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9924R-1.in silico     61  TAAATAACTTTAGTTTTTGTCGGGAAGAAATGGGTGAGGTACTCAAATCGTCCACATTCT 120


9924R-1.IR_full       121 CAGCCGGTGCTAATGACAAACTAAAATGGTGTTTACGGGTTAACCCCAAGGGTCTCGACG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9924R-1.in silico     121 CAGCCGGTGCTAATGACAAACTAAAATGGTGTTTACGGGTTAACCCCAAGGGTCTCGACG 180


9924R-1.IR_full       181 AGGAGAGCAAGGATTACCTTTCTTTATATTTACTGTTAGTTTCGTGTAATAAATCAGAAG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9924R-1.in silico     181 AGGAGAGCAAGGATTACCTTTCTTTATATTTACTGTTAGTTTCGTGTAATAAATCAGAAG 240


9924R-1.IR_full       241 TCAGAGCCAAGTTCAAATTTTCCATACTGAATGCGAAGCGTGAGGAAACCAAAGCAATGG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9924R-1.in silico     241 TCAGAGCCAAGTTCAAATTTTCCATACTGAATGCGAAGCGTGAGGAAACCAAAGCAATGG 300


9924R-1.IR_full       301 AATCCCAAAGAGCTTATCGTTTTGTGCAGGGCAAAGATTGGGGCTTCAAGAAGTTCATCC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9924R-1.in silico     301 AATCCCAAAGAGCTTATCGTTTTGTGCAGGGCAAAGATTGGGGCTTCAAGAAGTTCATCC 360


9924R-1.IR_full       361 GACGAGACTTCCTGCTGGAACGAGGCCAACNGCCTGCTGCCGGAGGATAAGCTGACCATC 420
                          |||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||
9924R-1.in silico     361 GACGAGACTTCCTGCTGG-ACGAGGCCAACGGCCTGCTGCCGGAGGATAAGCTGACCATC 420


9924R-1.IR_full       421 TTCTGCGAGGTCAGCGTCGTGGCGGACAGCGTGAACATCTCCGGACAATCCAATATCGTG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9924R-1.in silico     421 TTCTGCGAGGTCAGCGTCGTGGCGGACAGCGTGAACATCTCCGGACAATCCAATATCGTG 480


9924R-1.IR_full       481 CAGTTCAAAGTGCCCGAATGC 501
                          |||||||||||||||||||||
9924R-1.in silico     481 CAGTTCAAAGTGCCCGAATGC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_169566.1  CG9924-RB, transcript variant B (CG9924), mRNA 
100   482  NM_142068.1  CG9924-RC, transcript variant C (CG9924), mRNA 
100   482  NM_169564.1  CG9924-RD, transcript variant D (CG9924), mRNA 
100   482  NM_001038965.1  CG9924-RE, transcript variant E (CG9924), mRNA 
100   482  NM_169565.1  CG9924-RA, transcript variant A (CG9924), mRNA 
0   NM_137455.4  CG10915-RA (CG10915), mRNA 
0   NM_169576.1  CG31321-RB (CG31321), mRNA 
0   NM_001043110.1  CG6883-RB, transcript variant B (trh), mRNA 
0   NM_079148.2  CG6883-RA, transcript variant A (trh), mRNA 
0   NM_132184.1  CG15327-RA (CG15327), mRNA 
0   NM_137169.3  CG11798-RA, transcript variant A (chn), mRNA 
0   NM_206119.1  CG11798-RB, transcript variant B (chn), mRNA 
0   NM_001043082.1  CG11798-RC, transcript variant C (chn), mRNA 
0   NM_079503.2  CG9761-RA (Nep2), mRNA 
0   NM_142809.2  CG6937-RA (CG6937), mRNA 
0   NM_170026.1  CG5264-RA (btn), mRNA 
0   NM_134496.2  CG14215-RA (CG14215), mRNA 
0   NM_080301.2  CG3848-RC, transcript variant C (trr), mRNA 
0   NM_166911.3  CG3848-RD, transcript variant D (trr), mRNA 
0   NM_140636.2  CG4672-RA (TMS1), mRNA 
0   NM_206227.1  CG12038-RA, transcript variant A (CG12038), mRNA 
0   NM_206226.1  CG12038-RB, transcript variant B (CG12038), mRNA 
0   NM_136693.2  CG12130-RA (CG12130), mRNA 
0   NM_057384.3  CG3956-RA (sna), mRNA 
0   NM_079845.2  CG7951-RA (sima), mRNA 
0   NM_080335.2  CG2984-RA (Pp2C1), mRNA 
0   NM_141829.2  CG14709-RA (CG14709), mRNA 
0   NM_137492.1  CG17669-RA (CG17669), mRNA 
0   NM_132519.1  CG9369-RA (m), mRNA 
0   NM_138115.2  CG30421-RA (CG30421), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.