National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9904R-2 
 Symbol CG9904  Full Name CG9904 
 CG No CG9904  Old CG No CG9904 
 Synonyms EG:BACR7C10.1, CG9904 
 Accession No (Link to NCBI) NM_130656.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS One (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCATCCTGCTGCGCTTAATCGT 
 Primer Seq. 3'
aatctagaggtaccTCATGGCAGACCGACAGGAGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CATCCTGCTG CGCTTAATCG TCTTCGCCCT GGATCCTCTG GGTCTGGGCC GACGTTTCCT 
0061 CATCCGGCCT GCCGTGAATC TGGGCTGGAA CGTCTACGAT CGCGTGCGCA GCAAGGCGGA 
0121 CGAGAAGGTG GGCACGGTGC GAGAGCTGGT CCTCCGGCTG GGCCTCATCG CCTTCGCCGT 
0181 GGTGCTCATC ATCTGGCTGG CGGTCTTCAT GTACGCCGCC TTCTACTACG TCTACATGCC 
0241 GGCCATATCG CACACCCGAC CCGTTCACAT GCAGTTCAAA ACCTGCCTGG AGACCAGCAC 
0301 GCCCTGCACC TTTCCGCACG CGCACGTCTC GCTGACAAAG AAGCAGCAAC TCCTGATGGT 
0361 TGGCCAGGCG TACAAGGTGA TCGTGAACAT CGACATGCCG GAGTCGCCGC AAAATCTCGA 
0421 GCTGGGCATG TTCATGGTGT GCGCCGAGAT GAGGGACTAC GACTCGATGC TGAGGGGTCA 
0481 CTCCTGTCGG TCTGCCATGA  
 in silico PCR Fragment
0001 CATCCTGCTG CGCTTAATCG TCTTCGCCCT GGATCCTCTG GGTCTGGGCC GACGTTTCCT 
0061 CATTCGGCCG GCCGTGAATC TGGGCTGGAA TGTCTACGAT CGCGTGCGCA GCAAGGCGGA 
0121 CGAGAAGGTG GGCACGGTGC GAGAGCTGGT CCTCCGGCTG GGCCTCATCG CCTTCGCCGT 
0181 GGTGCTCATC ATCTGGCTGG CGGTCTTCAT GTACGCCGCC TTCTACTACG TCTACATGCC 
0241 GGCCATATCG CACACCCGAC CCGTTCACAT GCAGTTCAAA ACCTGCCTGG AGACCAGCAC 
0301 GCCCTGCACC TTTCCGCACG CGCACGTCTC GCTGACAAAG AAGCAGCAAC TCCTGATGGT 
0361 TGGCCAGGCG TACAAGGTGA TCGTGAACAT CGACATGCCG GAGTCGCCGC AAAATCTCGA 
0421 GCTGGGCATG TTCATGGTGT GCGCCGAGAT GAGGGACTAC GACTCGATGC TGAGGGGTCA 
0481 CTCCTGTCGG TCTGCCATGA  
 Assemble Data

9904R-2.IR_full       1   CATCCTGCTGCGCTTAATCGTCTTCGCCCTGGATCCTCTGGGTCTGGGCCGACGTTTCCT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9904R-2.in silico     1   CATCCTGCTGCGCTTAATCGTCTTCGCCCTGGATCCTCTGGGTCTGGGCCGACGTTTCCT 60


9904R-2.IR_full       61  CATCCGGCCTGCCGTGAATCTGGGCTGGAACGTCTACGATCGCGTGCGCAGCAAGGCGGA 120
                          ||| ||||| |||||||||||||||||||| |||||||||||||||||||||||||||||
9904R-2.in silico     61  CATTCGGCCGGCCGTGAATCTGGGCTGGAATGTCTACGATCGCGTGCGCAGCAAGGCGGA 120


9904R-2.IR_full       121 CGAGAAGGTGGGCACGGTGCGAGAGCTGGTCCTCCGGCTGGGCCTCATCGCCTTCGCCGT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9904R-2.in silico     121 CGAGAAGGTGGGCACGGTGCGAGAGCTGGTCCTCCGGCTGGGCCTCATCGCCTTCGCCGT 180


9904R-2.IR_full       181 GGTGCTCATCATCTGGCTGGCGGTCTTCATGTACGCCGCCTTCTACTACGTCTACATGCC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9904R-2.in silico     181 GGTGCTCATCATCTGGCTGGCGGTCTTCATGTACGCCGCCTTCTACTACGTCTACATGCC 240


9904R-2.IR_full       241 GGCCATATCGCACACCCGACCCGTTCACATGCAGTTCAAAACCTGCCTGGAGACCAGCAC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9904R-2.in silico     241 GGCCATATCGCACACCCGACCCGTTCACATGCAGTTCAAAACCTGCCTGGAGACCAGCAC 300


9904R-2.IR_full       301 GCCCTGCACCTTTCCGCACGCGCACGTCTCGCTGACAAAGAAGCAGCAACTCCTGATGGT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9904R-2.in silico     301 GCCCTGCACCTTTCCGCACGCGCACGTCTCGCTGACAAAGAAGCAGCAACTCCTGATGGT 360


9904R-2.IR_full       361 TGGCCAGGCGTACAAGGTGATCGTGAACATCGACATGCCGGAGTCGCCGCAAAATCTCGA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9904R-2.in silico     361 TGGCCAGGCGTACAAGGTGATCGTGAACATCGACATGCCGGAGTCGCCGCAAAATCTCGA 420


9904R-2.IR_full       421 GCTGGGCATGTTCATGGTGTGCGCCGAGATGAGGGACTACGACTCGATGCTGAGGGGTCA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9904R-2.in silico     421 GCTGGGCATGTTCATGGTGTGCGCCGAGATGAGGGACTACGACTCGATGCTGAGGGGTCA 480


9904R-2.IR_full       481 CTCCTGTCGGTCTGCCATGA 500
                          ||||||||||||||||||||
9904R-2.in silico     481 CTCCTGTCGGTCTGCCATGA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_130656.2  CG9904-RA (CG9904), mRNA 
0   NM_133097.1  CG6961-RA (CG6961), mRNA 
0   NM_133096.1  CG18259-RA (CG18259), mRNA 
0   NM_142189.3  CG6236-RA, transcript variant A (CG6236), mRNA 
0   NM_169646.2  CG6236-RB, transcript variant B (CG6236), mRNA 
0   NM_079872.4  CG1873-RA, transcript variant A (Ef1alpha100E), mRNA 
0   NM_206592.1  CG1873-RD, transcript variant D (Ef1alpha100E), mRNA 
0   NM_170570.1  CG1873-RB, transcript variant B (Ef1alpha100E), mRNA 
0   NM_206593.1  CG1873-RC, transcript variant C (Ef1alpha100E), mRNA 
0   NM_057218.3  CG9042-RC, transcript variant C (Gpdh), mRNA 
0   NM_057217.3  CG9042-RB, transcript variant B (Gpdh), mRNA 
0   NM_057219.3  CG9042-RA, transcript variant A (Gpdh), mRNA 
0   NM_132127.2  CG4542-RA (CG4542), mRNA 
0   NM_057831.3  CG5393-RB, transcript variant B (apt), mRNA 
0   NM_166609.1  CG5393-RC, transcript variant C (apt), mRNA 
0   NM_057832.3  CG5393-RA, transcript variant A (apt), mRNA 
0   NM_166610.1  CG5393-RD, transcript variant D (apt), mRNA 
0   NM_166611.1  CG5393-RE, transcript variant E (apt), mRNA 
0   NM_057339.3  CG9181-RA, transcript variant A (Ptp61F), mRNA 
0   NM_167875.1  CG9181-RD, transcript variant D (Ptp61F), mRNA 
0   NM_165836.1  CG7776-RB, transcript variant B (E(Pc)), mRNA 
0   NM_078974.2  CG7776-RA, transcript variant A (E(Pc)), mRNA 
0   NM_078679.2  CG6816-RB, transcript variant B (Cyp18a1), mRNA 
0   NM_167628.1  CG6816-RA, transcript variant A (Cyp18a1), mRNA 
0   NM_080272.2  CG18816-RA, transcript variant A (Tsp42Eb), mRNA 
0   NM_165503.1  CG18816-RB, transcript variant B (Tsp42Eb), mRNA 
0   NM_165504.1  CG30160-RA (CG30160), mRNA 
0   NM_139447.1  CG2034-RA (CG2034), mRNA 
0   NM_169200.1  CG31284-RA, transcript variant A (CG31284), mRNA 
0   NM_206459.1  CG31284-RC, transcript variant C (CG31284), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.