National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9903R-1 
 Symbol CG9903  Full Name CG9903 
 CG No CG9903  Old CG No CG9903 
 Synonyms CG9903 
 Accession No (Link to NCBI) NM_132904.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGATCTGAGTATGGCGACCTG 
 Primer Seq. 3'
aatctagaggtaccACAAATCGACTGACCACACCC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGATCTGAGT ATGGCGACCT GGCCGGCAAT TGGCTGGTGG ATTATGATCG AGACGAGCTG 
0061 AATTTTTTTG AGGATTCGAC TTGGAGCGTG GATTTGCACA TATACAATGT GTTACCGAAG 
0121 GACTCTTCGC TGGATTACTA CTTTGTGGTG TACTCCAAGG ATGATCGGAG GGCGTCATCG 
0181 CCACCGCTGG AGATAAAGAA GGAGGATTTC GATCTGTTGG GCAGCTGGCG GGGAGCGCTA 
0241 TATGTGACTG GAGTTCGCTT TGGATACAGT TCACTGGAGG TGGAACTGAA GTCCGGTGCG 
0301 GTGACGGAGA CATATCCAAA ACCCCTGCCA ATAACAGTGC TCAGAACACA GGTGGTGGAC 
0361 GAACGCATCA CCACCTATGT GTCCGCCGCC TTGNCTCTGC TGATGTTTCT CAATCTCGGA 
0421 ACAGTATTGG ATATGCAGCg CCTGGCGGGC ATCATCTGCC GACCGGTGGG ANCCTGTGGT 
0481 GGGTGTGGTC AGTCGATTTG T 
 in silico PCR Fragment
0001 CGATCTGAGT ATGGCGACCT GGCCGGCAAT TGGCTGGTGG ATTATGATCG AGACGAGCTG 
0061 AATTTTTTTG AGGATTCGAC TTGGAGCGTG GATTTGCACA TATACAATGT GTTACCGAAG 
0121 GACTCTTCGC TGGATTACTA CTTTGTGGTG TACTCCAAGG ATGATCGGAG GGCGTCATCG 
0181 CCACCGCTGG AGATAAAGAA GGAGGATTTC GATCTGTTGG GCAGCTGGCG GGGAGCGCTA 
0241 TATGTGACTG GAGTTCGCTT TGGATACAGT TCACTGGAGG TGGAACTGAA GTCCGGTGCG 
0301 GTGACGGAGA CATATCCAAA ACCCCTGCCA ATAACAGTGC TCAGAACACA GGTGGTGGAC 
0361 GAACGCATCA CCACCTATGT GTCCGCCGCC TTGGCTCTGC TGATGTTTCT CAATCTCGGA 
0421 ACAGTATTGG ATATGCAGCG CCTGGCGGGC ATCATCTGCC GACCGGTGGG A-CCTGTGGT 
0481 GGGTGTGGTC AGTCGATTTG T 
 Assemble Data

9903R-1.IR_full       1   CGATCTGAGTATGGCGACCTGGCCGGCAATTGGCTGGTGGATTATGATCGAGACGAGCTG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9903R-1.in silico     1   CGATCTGAGTATGGCGACCTGGCCGGCAATTGGCTGGTGGATTATGATCGAGACGAGCTG 60


9903R-1.IR_full       61  AATTTTTTTGAGGATTCGACTTGGAGCGTGGATTTGCACATATACAATGTGTTACCGAAG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9903R-1.in silico     61  AATTTTTTTGAGGATTCGACTTGGAGCGTGGATTTGCACATATACAATGTGTTACCGAAG 120


9903R-1.IR_full       121 GACTCTTCGCTGGATTACTACTTTGTGGTGTACTCCAAGGATGATCGGAGGGCGTCATCG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9903R-1.in silico     121 GACTCTTCGCTGGATTACTACTTTGTGGTGTACTCCAAGGATGATCGGAGGGCGTCATCG 180


9903R-1.IR_full       181 CCACCGCTGGAGATAAAGAAGGAGGATTTCGATCTGTTGGGCAGCTGGCGGGGAGCGCTA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9903R-1.in silico     181 CCACCGCTGGAGATAAAGAAGGAGGATTTCGATCTGTTGGGCAGCTGGCGGGGAGCGCTA 240


9903R-1.IR_full       241 TATGTGACTGGAGTTCGCTTTGGATACAGTTCACTGGAGGTGGAACTGAAGTCCGGTGCG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9903R-1.in silico     241 TATGTGACTGGAGTTCGCTTTGGATACAGTTCACTGGAGGTGGAACTGAAGTCCGGTGCG 300


9903R-1.IR_full       301 GTGACGGAGACATATCCAAAACCCCTGCCAATAACAGTGCTCAGAACACAGGTGGTGGAC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9903R-1.in silico     301 GTGACGGAGACATATCCAAAACCCCTGCCAATAACAGTGCTCAGAACACAGGTGGTGGAC 360


9903R-1.IR_full       361 GAACGCATCACCACCTATGTGTCCGCCGCCTTGNCTCTGCTGATGTTTCTCAATCTCGGA 420
                          ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
9903R-1.in silico     361 GAACGCATCACCACCTATGTGTCCGCCGCCTTGGCTCTGCTGATGTTTCTCAATCTCGGA 420


9903R-1.IR_full       421 ACAGTATTGGATATGCAGCGCCTGGCGGGCATCATCTGCCGACCGGTGGGANCCTGTGGT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||
9903R-1.in silico     421 ACAGTATTGGATATGCAGCGCCTGGCGGGCATCATCTGCCGACCGGTGGGA-CCTGTGGT 480


9903R-1.IR_full       481 GGGTGTGGTCAGTCGATTTGT 501
                          |||||||||||||||||||||
9903R-1.in silico     481 GGGTGTGGTCAGTCGATTTGT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_132904.1  CG9903-RA (CG9903), mRNA 
0   NM_206026.1  CG9403-RC, transcript variant C (jing), mRNA 
0   NM_206027.1  CG9403-RD, transcript variant D (jing), mRNA 
0   NM_136371.2  CG9403-RA, transcript variant A (jing), mRNA 
0   NM_132000.2  CG12730-RA (CG12730), mRNA 
0   NM_164846.2  CG31708-RB, transcript variant B (CG31708), mRNA 
0   NM_164845.2  CG31708-RA, transcript variant A (CG31708), mRNA 
0   NM_079217.2  CG10539-RA (S6k), mRNA 
0   NM_134916.3  CG9663-RA (CG9663), mRNA 
0   NM_176755.1  CG7122-RB, transcript variant B (RhoGAP16F), mRNA 
0   NM_078783.2  CG7068-RA (TepIII), mRNA 
0   NM_135858.2  CG15293-RA (CG15293), mRNA 
0   NM_079151.2  CG3217-RA, transcript variant A (CkIIalpha-i3), mRNA 
0   NM_167840.1  CG3217-RB, transcript variant B (CkIIalpha-i3), mRNA 
0   10  NM_132457.1  CG11122-RA (CG11122), mRNA 
0   NM_136843.1  CG9006-RA (l(2)k14708), mRNA 
0   NM_170188.1  CG6422-RB, transcript variant B (CG6422), mRNA 
0   NM_143065.2  CG6422-RA, transcript variant A (CG6422), mRNA 
0   NM_136086.4  CG31793-RA (CG31793), mRNA 
0   NM_142158.1  CG6966-RA (CG6966), mRNA 
0   NM_134702.1  CG3639-RA (CG3639), mRNA 
0   NM_164607.1  CG8892-RB, transcript variant B (CG8892), mRNA 
0   NM_164608.1  CG8892-RC, transcript variant C (CG8892), mRNA 
0   NM_176175.1  CG7449-RB, transcript variant B (hbs), mRNA 
0   NM_079963.3  CG7449-RA, transcript variant A (hbs), mRNA 
0   NM_164709.1  CG11321-RB, transcript variant B (CG11321), mRNA 
0   NM_135228.1  CG11321-RA, transcript variant A (CG11321), mRNA 
0   NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
0   NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
0   NM_140917.1  CG14186-RA (CG14186), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.