National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9891R-3 
 Symbol yellow-d2  Full Name yellow-d2 
 CG No CG9891  Old CG No CG9891 
 Synonyms CT27880, CG9891, yellow-d2 
 Accession No (Link to NCBI) NM_137944.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGCGTTGGATTGTCTTCGGTG 
 Primer Seq. 3'
aatctagaggtaccCTTGTACTGATGCGCGACTTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGCGTTGGAT TGTCTTCGGT GTCTNCTGNT TGGTGCTGGC TGGNAGcATC CGCCCAGGCC 
0061 TTGGAAAGTG TCTTTGGAGC CTACAATCTG GAGCTGGAGT TTCCATCGCC GCANGAAAGA 
0121 CAGCGCGCGC TGAGAGAGGG ACTCTACGAT CCGGGCAGCG TGATCCCCCA TCGATGTGGA 
0181 CGTCTACTAC AAGCATGGCG ATGCCACACC CTCGATATTC GTGACCATTC CGCGTTTTgC 
0241 CAAGGGCGTT CCATACTCTC TGGCCTACGT CACAAACGAA ATGCGACCGA ACGGGACTCT 
0301 CCTGCAGGCT TATCCCAGCT ACGAGTGGCA CAAATCCCAC GGAGCCGACT GCAATGGATT 
0361 GACTTCGGTG TACCGCACAC AGATAGACGA GTGCGGGCGC ATGTGGATCC TGGACAGCGG 
0421 CGAGATCGAC TTCATTCAGC ACTGCNCCGC CGCAGCTGTA CGCTATTGAC TTGGAAAGCG 
0481 GAAAAGTCGC GCATCAGTAC AAG 
 in silico PCR Fragment
0001 AGCGTTGGAT TGTCTTCGGT GTCTGCTG-T TGGTGCTGGC TGGCAGCATC CGCCCAGGCC 
0061 TTGGAAAGTG TCTTTGGAGC CTACAATCTG GAGCTGGAGT TTCCATCGCC GCAGGAAAGA 
0121 CAGCGCGCGC TGAGAGATGG ACTATACGAT CCGGGCAGCG TGAT-CCCCA TCGATGTGGA 
0181 CGTCTACTAC AAGCATGGCG ATGCCACACC CTCGATATTC GTGACCATTC CGCGTTTTGC 
0241 CAAGGGCGTT CCATACTCTC TGGCCTACGT CACAAACGAA ATGCGACCGA ACGGGACTCT 
0301 CCTGCAGGCT TATCCCAGCT ACGAGTGGCA CAAATCCCAC GGAGCCGACT GCAATGGATT 
0361 GACTTCGGTG TACCGCACAC AGATAGACGA GTGCGGGCGC ATGTGGATCC TGGACAGCGG 
0421 CGAGATCGAC TTCATTCAGC ACTGC-CCGC CGCAGCTGTA CGCTATTGAC TTGGAAAGCG 
0481 GAAAAGTCGC GCATCAGTAC AAG 
 Assemble Data

9891R-3.IR_full       1   AGCGTTGGATTGTCTTCGGTGTCTNCTGNTTGGTGCTGGCTGGNAGCATCCGCCCAGGCC 60
                          |||||||||||||||||||||||| ||| |||||||||||||| ||||||||||||||||
9891R-3.in silico     1   AGCGTTGGATTGTCTTCGGTGTCTGCTG-TTGGTGCTGGCTGGCAGCATCCGCCCAGGCC 60


9891R-3.IR_full       61  TTGGAAAGTGTCTTTGGAGCCTACAATCTGGAGCTGGAGTTTCCATCGCCGCANGAAAGA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
9891R-3.in silico     61  TTGGAAAGTGTCTTTGGAGCCTACAATCTGGAGCTGGAGTTTCCATCGCCGCAGGAAAGA 120


9891R-3.IR_full       121 CAGCGCGCGCTGAGAGAGGGACTCTACGATCCGGGCAGCGTGATCCCCCATCGATGTGGA 180
                          ||||||||||||||||| ||||| |||||||||||||||||||| |||||||||||||||
9891R-3.in silico     121 CAGCGCGCGCTGAGAGATGGACTATACGATCCGGGCAGCGTGAT-CCCCATCGATGTGGA 180


9891R-3.IR_full       181 CGTCTACTACAAGCATGGCGATGCCACACCCTCGATATTCGTGACCATTCCGCGTTTTGC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9891R-3.in silico     181 CGTCTACTACAAGCATGGCGATGCCACACCCTCGATATTCGTGACCATTCCGCGTTTTGC 240


9891R-3.IR_full       241 CAAGGGCGTTCCATACTCTCTGGCCTACGTCACAAACGAAATGCGACCGAACGGGACTCT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9891R-3.in silico     241 CAAGGGCGTTCCATACTCTCTGGCCTACGTCACAAACGAAATGCGACCGAACGGGACTCT 300


9891R-3.IR_full       301 CCTGCAGGCTTATCCCAGCTACGAGTGGCACAAATCCCACGGAGCCGACTGCAATGGATT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9891R-3.in silico     301 CCTGCAGGCTTATCCCAGCTACGAGTGGCACAAATCCCACGGAGCCGACTGCAATGGATT 360


9891R-3.IR_full       361 GACTTCGGTGTACCGCACACAGATAGACGAGTGCGGGCGCATGTGGATCCTGGACAGCGG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9891R-3.in silico     361 GACTTCGGTGTACCGCACACAGATAGACGAGTGCGGGCGCATGTGGATCCTGGACAGCGG 420


9891R-3.IR_full       421 CGAGATCGACTTCATTCAGCACTGCNCCGCCGCAGCTGTACGCTATTGACTTGGAAAGCG 480
                          ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
9891R-3.in silico     421 CGAGATCGACTTCATTCAGCACTGC-CCGCCGCAGCTGTACGCTATTGACTTGGAAAGCG 480


9891R-3.IR_full       481 GAAAAGTCGCGCATCAGTACAAG 503
                          |||||||||||||||||||||||
9891R-3.in silico     481 GAAAAGTCGCGCATCAGTACAAG 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  10  NM_137944.2  CG9891-RA (yellow-d2), mRNA 
0   NM_168811.1  CG32209-RB (CG32209), mRNA 
0   NM_206052.1  CG12822-RB, transcript variant B (CG12822), mRNA 
0   NM_136483.2  CG12822-RA, transcript variant A (CG12822), mRNA 
0   NM_165566.1  CG18853-RA (CG18853), mRNA 
0   NM_136553.2  CG8639-RA (Cirl), mRNA 
0   NM_168364.1  CG16707-RB, transcript variant B (vsg), mRNA 
0   NM_168362.1  CG16707-RD, transcript variant D (vsg), mRNA 
0   NM_140092.1  CG16707-RC, transcript variant C (vsg), mRNA 
0   NM_168363.1  CG16707-RA, transcript variant A (vsg), mRNA 
0   NM_206011.2  CG9326-RD, transcript variant D (CG9326), mRNA 
0   NM_165343.2  CG9326-RC, transcript variant C (CG9326), mRNA 
0   NM_165342.3  CG9326-RB, transcript variant B (CG9326), mRNA 
0   NM_132403.3  CG17255-RA, transcript variant A (CG17255), mRNA 
0   NM_167231.3  CG17255-RB, transcript variant B (CG17255), mRNA 
0   NM_166292.1  CG30116-RA, transcript variant A (CG30116), mRNA 
0   NM_137493.2  CG30116-RC, transcript variant C (CG30116), mRNA 
0   NM_166291.1  CG30116-RD, transcript variant D (CG30116), mRNA 
0   NM_137494.1  CG30116-RB, transcript variant B (CG30116), mRNA 
0   NM_140522.1  CG16979-RA (CG16979), mRNA 
0   NM_139555.1  CG12010-RA, transcript variant A (CG12010), mRNA 
0   NM_168030.1  CG12010-RB, transcript variant B (CG12010), mRNA 
0   NM_132429.2  CG2202-RA (CG2202), mRNA 
0   NM_080253.2  CG5067-RA (cic), mRNA 
0   NM_080332.2  CG11427-RA (rb), mRNA 
0   NM_080358.2  CG1484-RA (fliI), mRNA 
0   NM_132126.1  CG3075-RA (CG3075), mRNA 
0   12  NM_168422.1  CG7958-RB, transcript variant B (tna), mRNA 
0   12  NM_140155.2  CG7958-RA, transcript variant A (tna), mRNA 
0   10  NM_079039.2  CG8380-RA (DAT), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.