National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9883R-3 
 Symbol CG9883  Full Name CG9883 
 CG No CG9883  Old CG No CG9883 
 Synonyms CG9883 
 Accession No (Link to NCBI) NM_134847.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATAGCGAGGCTCCGGAATTCA 
 Primer Seq. 3'
aatctagaggtaccCTGGATTTTGGCCACTTGCTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATAGCGAGGC TCCNGGAATT CAGCATGTCA GTCGTTTGCA AAANCGGAGC CGCACTACTT 
0061 TCATCCGCAG ACTGCGATCC TGCCCAGCGT GCAGTACTCC CACCCATATC ACCACTATCT 
0121 GAGCCAGTTC GCCCCGAACT TCGTGCCCTA CTACTACCGC CTGCTCTCGC GGCCTATAAT 
0181 GAAGCAGGAG GAGATGGACA TCGAGAACTA CATCAACTAC GAGGTGGCCG CCCAGCAGAC 
0241 CATGATGCGC CAGCGGACCC TGAAGCCCCT GGGTCAGCTG CAGATCCAAA TGCCGCCTCC 
0301 CATAATAGTC AACCAGCCAG TTAAGCCAGT TCCCGTTAAg GCAGTGCCAG TCCGCCGAAG 
0361 CTCTCCGCCC AAGCGACGCG TCATCAATGC CCAGTTGGNT AgcGGTAGCC ACCGCTTCCG 
0421 GGGGCATTAA GAACATCGAA CCGCGGGTGG AGCCACTGCC TCGCCTGGAG GAATCCTTTA 
0481 AGCAGCAAGT GGCCAAAATC CAG 
 in silico PCR Fragment
0001 ATAGCGAGGC TCC-GGAATT CAGCATGTCA GTCGTTTGCA AAA-CGGAGC CGCACTACTT 
0061 TCATCCGCAG ACTGCTATCC TGCCCAGCGT CCAGTACTCC CACCCATATC ACCACTATCT 
0121 GAGCCAGTTC GCCCCGAACT TCGTGCCCTA CTACTACCGC CTGCTCTCGC GGCCCATAAT 
0181 GAAGCAGGAG GAGATGGACA TCGAGAACTA CATCAACTAC GAGGTGGCCG CCCAGCAGAC 
0241 CATGATGCGC CAGCGGACCC TGAAGCCCCT GGGTCAGCTG CAGATCCAAA TGCCGCCTCC 
0301 CATAATAGTC AACCAGCCAG TTAAGCCAGT TCCCGTTAAG GCAGTGCCAG TCCGCCGAAG 
0361 CTCTCCGCCC AAGCGACGCG TCATCAATGC CCAGTTGG-T AGCGGTAGCC ACCGCTTCCG 
0421 GGGGCATTAA GAACATCGAA CCGCGGGTGG AGCCACTGCC TCGCCTGGAG GAATCCTTTA 
0481 AGCAGCAAGT GGCCAAAATC CAG 
 Assemble Data

9883R-3.IR_full       1   ATAGCGAGGCTCCNGGAATTCAGCATGTCAGTCGTTTGCAAAANCGGAGCCGCACTACTT 60
                          ||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||
9883R-3.in silico     1   ATAGCGAGGCTCC-GGAATTCAGCATGTCAGTCGTTTGCAAAA-CGGAGCCGCACTACTT 60


9883R-3.IR_full       61  TCATCCGCAGACTGCGATCCTGCCCAGCGTGCAGTACTCCCACCCATATCACCACTATCT 120
                          ||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||
9883R-3.in silico     61  TCATCCGCAGACTGCTATCCTGCCCAGCGTCCAGTACTCCCACCCATATCACCACTATCT 120


9883R-3.IR_full       121 GAGCCAGTTCGCCCCGAACTTCGTGCCCTACTACTACCGCCTGCTCTCGCGGCCTATAAT 180
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
9883R-3.in silico     121 GAGCCAGTTCGCCCCGAACTTCGTGCCCTACTACTACCGCCTGCTCTCGCGGCCCATAAT 180


9883R-3.IR_full       181 GAAGCAGGAGGAGATGGACATCGAGAACTACATCAACTACGAGGTGGCCGCCCAGCAGAC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9883R-3.in silico     181 GAAGCAGGAGGAGATGGACATCGAGAACTACATCAACTACGAGGTGGCCGCCCAGCAGAC 240


9883R-3.IR_full       241 CATGATGCGCCAGCGGACCCTGAAGCCCCTGGGTCAGCTGCAGATCCAAATGCCGCCTCC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9883R-3.in silico     241 CATGATGCGCCAGCGGACCCTGAAGCCCCTGGGTCAGCTGCAGATCCAAATGCCGCCTCC 300


9883R-3.IR_full       301 CATAATAGTCAACCAGCCAGTTAAGCCAGTTCCCGTTAAGGCAGTGCCAGTCCGCCGAAG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9883R-3.in silico     301 CATAATAGTCAACCAGCCAGTTAAGCCAGTTCCCGTTAAGGCAGTGCCAGTCCGCCGAAG 360


9883R-3.IR_full       361 CTCTCCGCCCAAGCGACGCGTCATCAATGCCCAGTTGGNTAGCGGTAGCCACCGCTTCCG 420
                          |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||
9883R-3.in silico     361 CTCTCCGCCCAAGCGACGCGTCATCAATGCCCAGTTGG-TAGCGGTAGCCACCGCTTCCG 420


9883R-3.IR_full       421 GGGGCATTAAGAACATCGAACCGCGGGTGGAGCCACTGCCTCGCCTGGAGGAATCCTTTA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9883R-3.in silico     421 GGGGCATTAAGAACATCGAACCGCGGGTGGAGCCACTGCCTCGCCTGGAGGAATCCTTTA 480


9883R-3.IR_full       481 AGCAGCAAGTGGCCAAAATCCAG 503
                          |||||||||||||||||||||||
9883R-3.in silico     481 AGCAGCAAGTGGCCAAAATCCAG 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134847.2  CG9883-RA (CG9883), mRNA 
0   NM_168807.2  CG8765-RB, transcript variant B (CG8765), mRNA 
0   NM_140884.2  CG8765-RA, transcript variant A (CG8765), mRNA 
0   NM_143366.2  CG9986-RA (CG9986), mRNA 
0   NM_133086.2  CG6540-RA (CG6540), mRNA 
0   NM_135090.2  CG7277-RA (CG7277), mRNA 
0   NM_167399.4  CG12047-RB, transcript variant B (mud), mRNA 
0   NM_167400.3  CG12047-RA, transcript variant A (mud), mRNA 
0   NM_139732.2  CG10542-RA (CG10542), mRNA 
0   NM_140370.1  CG11274-RA (SRm160), mRNA 
0   11  NM_165836.1  CG7776-RB, transcript variant B (E(Pc)), mRNA 
0   11  NM_078974.2  CG7776-RA, transcript variant A (E(Pc)), mRNA 
0   NM_078535.2  CG1634-RA, transcript variant A (Nrg), mRNA 
0   NM_167160.1  CG1634-RB, transcript variant B (Nrg), mRNA 
0   NM_206657.1  CG1634-RC, transcript variant C (Nrg), mRNA 
0   NM_167196.1  CG12141-RB, transcript variant B (Aats-lys), mRNA 
0   NM_132345.1  CG12141-RA, transcript variant A (Aats-lys), mRNA 
0   NM_136094.1  CG10493-RA (CG10493), mRNA 
0   NM_143196.1  CG8968-RA (CG8968), mRNA 
0   NM_140795.2  CG4120-RA (Cyp12c1), mRNA 
0   NM_057547.3  CG18345-RA, transcript variant A (trpl), mRNA 
0   NM_165694.1  CG18345-RB, transcript variant B (trpl), mRNA 
0   NM_143636.1  CG2135-RA (CG2135), mRNA 
0   NM_165695.1  CG18345-RC, transcript variant C (trpl), mRNA 
0   NM_001014465.1  CG31660-RC, transcript variant C (CG31660), mRNA 
0   NM_079454.2  CG6948-RA (Clc), mRNA 
0   NM_164600.2  CG31660-RB, transcript variant B (CG31660), mRNA 
0   NM_057746.3  CG11992-RA, transcript variant A (Rel), mRNA 
0   NM_206467.1  CG11992-RB, transcript variant B (Rel), mRNA 
0   NM_206466.1  CG11992-RC, transcript variant C (Rel), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.