National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9883R-1 
 Symbol CG9883  Full Name CG9883 
 CG No CG9883  Old CG No CG9883 
 Synonyms CG9883 
 Accession No (Link to NCBI) NM_134847.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          ||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||| silico     1   ATAGCGAGGCTCC-GGAATTCAGCATGTCAGTCGTTTGCAAAA-CGGAGCCGCACTACTT 60

                          ||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||| silico     61  TCATCCGCAGACTGCTATCCTGCCCAGCGTCCAGTACTCCCACCCATATCACCACTATCT 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| silico     121 GAGCCAGTTCGCCCCGAACTTCGTGCCCTACTACTACCGCCTGCTCTCGCGGCCCATAAT 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GAAGCAGGAGGAGATGGACATCGAGAACTACATCAACTACGAGGTGGCCGCCCAGCAGAC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CATGATGCGCCAGCGGACCCTGAAGCCCCTGGGTCAGCTGCAGATCCAAATGCCGCCTCC 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CATAATAGTCAACCAGCCAGTTAAGCCAGTTCCCGTTAAGGCAGTGCCAGTCCGCCGAAG 360

                          |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| silico     361 CTCTCCGCCCAAGCGACGCGTCATCAATGCCCAGTTGG-TAGCGGTAGCCACCGCTTCCG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GGGGCATTAAGAACATCGAACCGCGGGTGGAGCCACTGCCTCGCCTGGAGGAATCCTTTA 480

9883R-1.IR_full       481 AGCAGCAAGTGGCCAAAATCCAG 503
                          ||||||||||||||||||||||| silico     481 AGCAGCAAGTGGCCAAAATCCAG 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_134847.2  CG9883-RA (CG9883), mRNA 
0   NM_168807.2  CG8765-RB, transcript variant B (CG8765), mRNA 
0   NM_140884.2  CG8765-RA, transcript variant A (CG8765), mRNA 
0   NM_143366.2  CG9986-RA (CG9986), mRNA 
0   NM_133086.2  CG6540-RA (CG6540), mRNA 
0   NM_135090.2  CG7277-RA (CG7277), mRNA 
0   NM_167399.4  CG12047-RB, transcript variant B (mud), mRNA 
0   NM_167400.3  CG12047-RA, transcript variant A (mud), mRNA 
0   NM_139732.2  CG10542-RA (CG10542), mRNA 
0   NM_140370.1  CG11274-RA (SRm160), mRNA 
0   11  NM_165836.1  CG7776-RB, transcript variant B (E(Pc)), mRNA 
0   11  NM_078974.2  CG7776-RA, transcript variant A (E(Pc)), mRNA 
0   NM_078535.2  CG1634-RA, transcript variant A (Nrg), mRNA 
0   NM_167160.1  CG1634-RB, transcript variant B (Nrg), mRNA 
0   NM_206657.1  CG1634-RC, transcript variant C (Nrg), mRNA 
0   NM_167196.1  CG12141-RB, transcript variant B (Aats-lys), mRNA 
0   NM_132345.1  CG12141-RA, transcript variant A (Aats-lys), mRNA 
0   NM_136094.1  CG10493-RA (CG10493), mRNA 
0   NM_143196.1  CG8968-RA (CG8968), mRNA 
0   NM_140795.2  CG4120-RA (Cyp12c1), mRNA 
0   NM_057547.3  CG18345-RA, transcript variant A (trpl), mRNA 
0   NM_165694.1  CG18345-RB, transcript variant B (trpl), mRNA 
0   NM_143636.1  CG2135-RA (CG2135), mRNA 
0   NM_165695.1  CG18345-RC, transcript variant C (trpl), mRNA 
0   NM_001014465.1  CG31660-RC, transcript variant C (CG31660), mRNA 
0   NM_079454.2  CG6948-RA (Clc), mRNA 
0   NM_164600.2  CG31660-RB, transcript variant B (CG31660), mRNA 
0   NM_057746.3  CG11992-RA, transcript variant A (Rel), mRNA 
0   NM_206467.1  CG11992-RB, transcript variant B (Rel), mRNA 
0   NM_206466.1  CG11992-RC, transcript variant C (Rel), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.