National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9809R-1 
 Symbol CG9809  Full Name CG9809 
 CG No CG9809  Old CG No CG9809 
 Synonyms cg9809, CG9809 
 Accession No (Link to NCBI) NM_141212.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTGAGCGGCATCCTACCCATC 
 Primer Seq. 3'
aatctagaggtaccCCCAATGCGTCTACTTCGGAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NTGAGCGGCN TCCTACCCAT CGCGCCCACA GACGAATCAC TGCTCAACCA TAACCGGGAG 
0061 NAAGATCTGC AAAACAGAAA GAATCTGCTG ATTTACAACG ACTTTCTGAA ACAGGAGCTC 
0121 AGCAACCATG ATGCCAANTG AGCTANAATG CCCANGGTCT ANTCGGTCTN ACATCGCCGA 
0181 CATGCGGGGG CGAGATTCGC CTATGAGCAG CAGCGCCAGA TCAGCGCCAT TGTGGAGTAC 
0241 GACAAAGAAG ATATTAAAAT CGACGGCCTT ACGGAGGAGG AGGACATACA AAGCCAGTCC 
0301 ACATTTCGCA CCCGCACAGA CAGCTCTTCG ATTGGTGACT ATGAATCGCA CTCTAGCGAC 
0361 TATGATGATG AATTTGACAT TGTCAACGAA GAAAAAAGTC CAAGGCTGCA GGTTGTCCAT 
0421 AACAATATCG GCAACTTGCA GAGCTCCTGT GAGCGCAAGG GACGGACGCT CAGTACTAAC 
0481 ACTATTATCT CCGAAGTAGA CGCATTGGG 
 in silico PCR Fragment
0001 CTGAGCGGCA TCCTACCCAT CGCGCCCACA GACGAATCAC TGCTCAACCA TAACCGGGAG 
0061 GAAGATCTGC AAAACAGAAA GAATCTGCTG ATTTACAACG ACTTTCTGAA ACAGGAGCTC 
0121 AGCAACCATG ATGCCAA-TG AGCTA-AATG CCCA-GGTCT A-TCGGTC-- -CATCGCCGA 
0181 CA-GCGGGGG CGAGATT-GC CTATGAGCAG CAGCGCCAGA TCAGCGCCAT TGTGGAGTAC 
0241 GACAAAGAAG ATATTAAAAT CGACGGCCTT ACGGAGGAGG AGGACATACA AAGCCAGTCC 
0301 ACATTTCGCA CCCGCACAGA CAGCTCTTCG ATTGGTGACT ATGAATCGCA CTCTAGCGAC 
0361 TATGATGATG AATTTGACAT TGTCAACGAA GAAAAAAGTC CAAGGCTGCA GGTTGTCCAT 
0421 AACAATATCG GCAACTTGCA GAGCTCCTGT GAGCGCAAGG GACGGACGCT CAGTACTAAC 
0481 ACTATTATCT CCGAAGTAGA CGCATTGGG 
 Assemble Data

9809R-1.IR_full        1   TGAGCGGCNTCCTACCCATCGCGCCCACAGACGAATCACTGCTCAACCATAACCGGGAG 59
                           |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||
9809R-1.in silico      1   TGAGCGGCATCCTACCCATCGCGCCCACAGACGAATCACTGCTCAACCATAACCGGGAG 59


9809R-1.IR_full        61  AAGATCTGCAAAACAGAAAGAATCTGCTGATTTACAACGACTTTCTGAAACAGGAGCTC 118
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9809R-1.in silico      61  AAGATCTGCAAAACAGAAAGAATCTGCTGATTTACAACGACTTTCTGAAACAGGAGCTC 118


9809R-1.IR_full       121 AGCAACCATGATGCCAANTGAGCTANAATGCCCANGGTCTANTCGGTCTNACATCGCCGA 178
                          ||||||||||||||||| ||||||| |||||||| |||||| ||||||   |||||||||
9809R-1.in silico     121 AGCAACCATGATGCCAA-TGAGCTA-AATGCCCA-GGTCTA-TCGGTC---CATCGCCGA 178


9809R-1.IR_full       181 CATGCGGGGGCGAGATTCGCCTATGAGCAGCAGCGCCAGATCAGCGCCATTGTGGAGTAC 238
                          || |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||
9809R-1.in silico     181 CA-GCGGGGGCGAGATT-GCCTATGAGCAGCAGCGCCAGATCAGCGCCATTGTGGAGTAC 238


9809R-1.IR_full       241 GACAAAGAAGATATTAAAATCGACGGCCTTACGGAGGAGGAGGACATACAAAGCCAGTCC 298
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9809R-1.in silico     241 GACAAAGAAGATATTAAAATCGACGGCCTTACGGAGGAGGAGGACATACAAAGCCAGTCC 298


9809R-1.IR_full       301 ACATTTCGCACCCGCACAGACAGCTCTTCGATTGGTGACTATGAATCGCACTCTAGCGAC 358
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9809R-1.in silico     301 ACATTTCGCACCCGCACAGACAGCTCTTCGATTGGTGACTATGAATCGCACTCTAGCGAC 358


9809R-1.IR_full       361 TATGATGATGAATTTGACATTGTCAACGAAGAAAAAAGTCCAAGGCTGCAGGTTGTCCAT 418
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9809R-1.in silico     361 TATGATGATGAATTTGACATTGTCAACGAAGAAAAAAGTCCAAGGCTGCAGGTTGTCCAT 418


9809R-1.IR_full       421 AACAATATCGGCAACTTGCAGAGCTCCTGTGAGCGCAAGGGACGGACGCTCAGTACTAAC 478
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9809R-1.in silico     421 AACAATATCGGCAACTTGCAGAGCTCCTGTGAGCGCAAGGGACGGACGCTCAGTACTAAC 478


9809R-1.IR_full       481 ACTATTATCTCCGAAGTAGACGCATTGGG 507
                          |||||||||||||||||||||||||||||
9809R-1.in silico     481 ACTATTATCTCCGAAGTAGACGCATTGGG 507

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   455  NM_168997.3  CG9809-RC, transcript variant C (CG9809), mRNA 
96.26   438  NM_141212.3  CG9809-RA, transcript variant A (CG9809), mRNA 
96.26   438  NM_168996.3  CG9809-RB, transcript variant B (CG9809), mRNA 
0   NM_164481.1  CG9866-RB, transcript variant B (CG9866), mRNA 
0   NM_134833.4  CG9866-RA, transcript variant A (CG9866), mRNA 
0   NM_001043224.1  CG34135-RB, transcript variant B (CG34135), mRNA 
0   NM_001043223.1  CG34135-RA, transcript variant A (CG34135), mRNA 
0   NM_133164.2  CG10142-RA (Ance-5), mRNA 
0   NM_137251.2  CG8443-RA (CG8443), mRNA 
0   NM_142964.2  CG6178-RA (CG6178), mRNA 
0   NM_165175.1  CG31782-RA, transcript variant A (CG31782), mRNA 
0   NM_165176.2  CG31782-RB, transcript variant B (CG31782), mRNA 
0   NM_079491.2  CG5723-RB (Ten-m), mRNA 
0   NM_134503.2  CG14231-RA (CG14231), mRNA 
0   14  NM_170158.1  CG5794-RB, transcript variant B (CG5794), mRNA 
0   14  NM_143018.2  CG5794-RD, transcript variant D (CG5794), mRNA 
0   NM_057328.3  CG3127-RA (Pgk), mRNA 
0   NM_166298.1  CG5489-RB, transcript variant B (Atg7), mRNA 
0   NM_137506.2  CG5489-RA, transcript variant A (Atg7), mRNA 
0   NM_169902.1  CG5191-RC, transcript variant C (CG5191), mRNA 
0   NM_169903.1  CG5191-RE, transcript variant E (CG5191), mRNA 
0   NM_169905.1  CG5191-RD, transcript variant D (CG5191), mRNA 
0   NM_135077.2  CG14023-RA (CG14023), mRNA 
0   NM_142636.1  CG5191-RB, transcript variant B (CG5191), mRNA 
0   NM_169904.1  CG5191-RA, transcript variant A (CG5191), mRNA 
0   NM_138220.1  CG13889-RA (CG13889), mRNA 
0   NM_001014543.1  CG6741-RC, transcript variant C (a), mRNA 
0   NM_166514.1  CG6741-RA, transcript variant A (a), mRNA 
0   NM_079902.2  CG6741-RB, transcript variant B (a), mRNA 
0   NM_140688.2  CG7728-RA (CG7728), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.