National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9804R-1 
 Symbol CG9804  Full Name CG9804 
 CG No CG9804  Old CG No CG9804 
 Synonyms CG9804 
 Accession No (Link to NCBI) NM_141215.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees male pupal lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGCCTTTTGTCCGACCGCTGGTGACCGTGGTGCGGGCCGGGCGGCATAGCTATTCAGCA 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GGATTACAGCTACAGCAACGTCTTGCAAGGTCCAACCAGATCCTGAATCCGCCAGCGGAG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TTCCGAAACTACCTGGTGCTTCAGGAGCACGACCCGGTCTACACAGTCGGACTAAGGACA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 AAGGACTATACGGCGCAGGATGAAGACCGACTCCGCCGGCTAGGAGCAGACTTCCATCGC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ACAGATCGCGGTGGCTTGATCACATTTCACGGCCCCGGCCAGTTGGTGGCCTATCCCATT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CTGCACCTGGGTCAGTTCGTGCCGAGCATCCGCTGGTACGTGGCGACGTTGGAGCGGATG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GTTGTCGAGGCCTGCCACCAGATGGGCATTTCCAGTGCCAAGGCGACCAAGGACACCGGT 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ATCTGGGTGGGTGACAACAAGATCTGTGCCATCGGTATCCACGGCTCGCGTTACGTCACC 480

9804R-1.IR_full       481 ACGCATGGAATCGGCCTCAA 500
                          |||||||||||||||||||| silico     481 ACGCATGGAATCGGCCTCAA 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_141215.2  CG9804-RA (CG9804), mRNA 
0   NM_079067.2  CG11949-RA, transcript variant A (cora), mRNA 
0   NM_166337.1  CG11949-RB, transcript variant B (cora), mRNA 
0   NM_001014481.1  CG7147-RC, transcript variant C (kuz), mRNA 
0   NM_165047.1  CG7147-RB, transcript variant B (kuz), mRNA 
0   NM_057839.3  CG7147-RA, transcript variant A (kuz), mRNA 
0   NM_136436.1  CG11125-RA (CG11125), mRNA 
0   NM_134830.1  CG3597-RA (CG3597), mRNA 
0   NM_165581.1  CG11198-RB, transcript variant B (CG11198), mRNA 
0   NM_136498.1  CG11198-RA, transcript variant A (CG11198), mRNA 
0   NM_057806.3  CG13279-RA (Cyt-b5-r), mRNA 
0   NM_168696.2  CG11905-RF, transcript variant F (CG11905), mRNA 
0   NM_168695.2  CG11905-RB, transcript variant B (CG11905), mRNA 
0   NM_169625.1  CG4264-RB, transcript variant B (Hsc70-4), mRNA 
0   NM_176503.1  CG4264-RF, transcript variant F (Hsc70-4), mRNA 
0   NM_169627.1  CG4264-RD, transcript variant D (Hsc70-4), mRNA 
0   NM_169626.1  CG4264-RC, transcript variant C (Hsc70-4), mRNA 
0   NM_176502.1  CG4264-RE, transcript variant E (Hsc70-4), mRNA 
0   NM_079632.4  CG4264-RA, transcript variant A (Hsc70-4), mRNA 
0   NM_079205.3  CG7507-RA, transcript variant A (Dhc64C), mRNA 
0   NM_001038743.1  CG33980-RA (CG33980), mRNA 
0   NM_168162.1  CG10173-RA (Best2), mRNA 
0   NM_136960.2  CG8785-RA, transcript variant A (CG8785), mRNA 
0   NM_165932.1  CG8785-RB, transcript variant B (CG8785), mRNA 
0   NM_167028.1  CG6775-RB, transcript variant B (rg), mRNA 
0   NM_080023.1  CG6775-RA, transcript variant A (rg), mRNA 
0   NM_001042796.1  CG6775-RC, transcript variant C (rg), mRNA 
0   NM_168368.1  CG32044-RA (CG32044), mRNA 
0   NM_079449.2  CG7978-RA (Ac76E), mRNA 
0   NM_079733.3  CG4677-RA, transcript variant A (lmd), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.