National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9699R-3 
 Symbol CG9699  Full Name CG9699 
 CG No CG9699  Old CG No CG9699 
 Synonyms CG9699 
 Accession No (Link to NCBI) NM_167530.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGCCAGCGTCATAAGCACGA 
 Primer Seq. 3'
aatctagaggtaccATTGTCCTGGATGTTGCGGCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGGCCAgcgT CATAAGCACG ATGAACGGCA GCAGCAGCAG TGGCATTGAG GCGGTTAAAT 
0061 GCCGACCACC CATTTACCCC AAACCTAAAA CGCCGTCGTT CGACAAGGAT CGCGATTACA 
0121 TAGGCTTTGc CACGCTTCCA GAGCAAGTGC ACCGGAAGTC GGTGAAGCGG GGCTTCGAGT 
0181 TCACCCTCAT GGTGGTCGGC GAGTCCGGAC TGGGCAAGTC CACGCTGATC AACAGCCTCT 
0241 TTCTGGGCGA TCTCTACAAG AACCGGCAGA TGCCCAATGT GGAGGAGCGC ATCGAGAAGA 
0301 CGACGAAGGT GGAGAAGAAG ACGATGGACA TCGAGGAGCG GGGCGTCCGN NTCCGGCTGA 
0361 CGGTGGTGGA CANCCCGGGA TTCGGGGATG CCATCAACTG TGAGGACAGC TGGCGCGTCT 
0421 GCACCCAGTA CATCGACGAG CAGTTCCGCC AGTACTTCAC CGACGAGAGC GGCCTGAAAT 
0481 CGCCGCAACA TCCAGGACAA T 
 in silico PCR Fragment
0001 TGGCCAGCGT CATAAGCACG ATGAACGGCA GCAGCAGCAG TGGCATTGAG GCGGTTAAAT 
0061 GCCGACCACC CATTTACCCC AAACCTAAAA CGCCGTCGTT CGACAAGGAT CGCGATTACA 
0121 TAGGCTTTGC CACGCTTCCA GAGCAAGTGC ACCGGAAGTC GGTGAAGCGG GGCTTCGAGT 
0181 TCACCCTCAT GGTGGTCGGC GAGTCCGGAC TGGGCAAGTC CACGCTGATC AACAGTCTCT 
0241 TTCTGGGCGA TCTCTACAAG AACCGGCAGA TGCCCAATGT GGAGGAGCGC ATCGAGAAGA 
0301 CGACGAAGGT GGAGAAGAAG ACGATGGACA TCGAGGAGCG GGGCGTCCGG CTCCGGCTGA 
0361 CGGTGGTGGA CACCCCGGGA TTCGGGGATG CCATCAACTG TGAGGACAGC TGGCGCGTCT 
0421 GCACCCAGTA CATCGACGAG CAGTTCCGCC AGTACTTCAC CGACGAGAGC GGCCTG-AAT 
0481 CGCCGCAACA TCCAGGACAA T 
 Assemble Data

9699R-3.IR_full       1   TGGCCAGCGTCATAAGCACGATGAACGGCAGCAGCAGCAGTGGCATTGAGGCGGTTAAAT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9699R-3.in silico     1   TGGCCAGCGTCATAAGCACGATGAACGGCAGCAGCAGCAGTGGCATTGAGGCGGTTAAAT 60


9699R-3.IR_full       61  GCCGACCACCCATTTACCCCAAACCTAAAACGCCGTCGTTCGACAAGGATCGCGATTACA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9699R-3.in silico     61  GCCGACCACCCATTTACCCCAAACCTAAAACGCCGTCGTTCGACAAGGATCGCGATTACA 120


9699R-3.IR_full       121 TAGGCTTTGCCACGCTTCCAGAGCAAGTGCACCGGAAGTCGGTGAAGCGGGGCTTCGAGT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9699R-3.in silico     121 TAGGCTTTGCCACGCTTCCAGAGCAAGTGCACCGGAAGTCGGTGAAGCGGGGCTTCGAGT 180


9699R-3.IR_full       181 TCACCCTCATGGTGGTCGGCGAGTCCGGACTGGGCAAGTCCACGCTGATCAACAGCCTCT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||
9699R-3.in silico     181 TCACCCTCATGGTGGTCGGCGAGTCCGGACTGGGCAAGTCCACGCTGATCAACAGTCTCT 240


9699R-3.IR_full       241 TTCTGGGCGATCTCTACAAGAACCGGCAGATGCCCAATGTGGAGGAGCGCATCGAGAAGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9699R-3.in silico     241 TTCTGGGCGATCTCTACAAGAACCGGCAGATGCCCAATGTGGAGGAGCGCATCGAGAAGA 300


9699R-3.IR_full       301 CGACGAAGGTGGAGAAGAAGACGATGGACATCGAGGAGCGGGGCGTCCGNNTCCGGCTGA 360
                          |||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||
9699R-3.in silico     301 CGACGAAGGTGGAGAAGAAGACGATGGACATCGAGGAGCGGGGCGTCCGGCTCCGGCTGA 360


9699R-3.IR_full       361 CGGTGGTGGACANCCCGGGATTCGGGGATGCCATCAACTGTGAGGACAGCTGGCGCGTCT 420
                          |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
9699R-3.in silico     361 CGGTGGTGGACACCCCGGGATTCGGGGATGCCATCAACTGTGAGGACAGCTGGCGCGTCT 420


9699R-3.IR_full       421 GCACCCAGTACATCGACGAGCAGTTCCGCCAGTACTTCACCGACGAGAGCGGCCTGAAAT 480
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
9699R-3.in silico     421 GCACCCAGTACATCGACGAGCAGTTCCGCCAGTACTTCACCGACGAGAGCGGCCTG-AAT 480


9699R-3.IR_full       481 CGCCGCAACATCCAGGACAAT 501
                          |||||||||||||||||||||
9699R-3.in silico     481 CGCCGCAACATCCAGGACAAT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_167530.1  CG9699-RA, transcript variant A (CG9699), mRNA 
100   482  NM_167534.1  CG9699-RF, transcript variant F (CG9699), mRNA 
100   482  NM_167532.1  CG9699-RD, transcript variant D (CG9699), mRNA 
100   482  NM_167533.1  CG9699-RE, transcript variant E (CG9699), mRNA 
100   482  NM_167531.1  CG9699-RB, transcript variant B (CG9699), mRNA 
100   482  NM_132919.2  CG9699-RC, transcript variant C (CG9699), mRNA 
82.57   398  NM_206766.1  CG9699-RG, transcript variant G (CG9699), mRNA 
2.48   12  22  56  42  NM_167747.1  CG1403-RB, transcript variant B (Sep1), mRNA 
2.48   12  22  56  42  NM_078706.2  CG1403-RA, transcript variant A (Sep1), mRNA 
0.41   17  NM_167231.3  CG17255-RB, transcript variant B (CG17255), mRNA 
0.41   17  NM_132403.3  CG17255-RA, transcript variant A (CG17255), mRNA 
0.2   NM_141633.1  CG8135-RA (CG8135), mRNA 
0.2   NM_001043296.1  CG5462-RG, transcript variant G (scrib), mRNA 
0.2   NM_170276.1  CG5462-RB, transcript variant B (scrib), mRNA 
0.2   NM_170275.1  CG5462-RA, transcript variant A (scrib), mRNA 
0.2   NM_001014670.2  CG5462-RH, transcript variant H (scrib), mRNA 
0.2   NM_080015.2  CG5462-RD, transcript variant D (scrib), mRNA 
0.2   NM_001014669.1  CG5462-RI, transcript variant I (scrib), mRNA 
0.2   NM_170277.1  CG5462-RC, transcript variant C (scrib), mRNA 
0   29  31  NM_057716.3  CG8705-RA, transcript variant A (pnut), mRNA 
0   29  31  NM_165597.1  CG8705-RB, transcript variant B (pnut), mRNA 
0   11  NM_079693.2  CG4173-RA (Sep2), mRNA 
0   26  NM_169580.1  CG8524-RB, transcript variant B (NK7.1), mRNA 
0   26  NM_142100.2  CG8524-RA, transcript variant A (NK7.1), mRNA 
0   11  NM_164516.1  CG8817-RA, transcript variant A (lilli), mRNA 
0   30  NM_164869.1  CG18660-RA, transcript variant A (Nckx30C), mRNA 
0   30  NM_164870.1  CG18660-RB, transcript variant B (Nckx30C), mRNA 
0   30  NM_143754.2  CG18660-RC, transcript variant C (Nckx30C), mRNA 
0   NM_137546.2  CG15105-RA, transcript variant A (CG15105), mRNA 
0   NM_166318.1  CG15105-RB, transcript variant B (CG15105), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.