National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9675R-3 
 Symbol spheroide  Full Name spheroide 
 CG No CG9675  Old CG No CG9675 
 Synonyms SPH114, anon-WO0140519.154, anon-EST:ParkEST153, spheroide, CG9675 
 Accession No (Link to NCBI) NM_132920.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr. Biol. (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGCAGCCGAGACTAGTGATT 
 Primer Seq. 3'
aatctagaggtaccATCTGACGGATCTTGTAGGAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 atGCAGCCGA GACTAGTGAT TTTGGNTCTG ATCGGATTGA CGGCGGTGGG CATGTGcCAC 
0061 GCCCAGGGAC GCATCATGGG AGGGGAGGAC GCGGACGcCA CAGCCACGAC CTTCACCGCC 
0121 TCCTTGCGNG TGGACAATGC CCATGTGTGC GGCGGTAGcA NTCTCTCCCA GACCAAAATC 
0181 CTGACCACCG CCCACTGTGT GCATCGCGAT GGAAAGCTAA TCGATGCCAG TCGCCTGGcG 
0241 TGCCGCGTGG GCAGNTACCA ACCAGTATGC TGGTGGCAAG ATTGTCAACG TGGAATCGGT 
0301 TGCAGTGCAT CCGGACTACT ATAATCTGAA CAACAACCTG GCCGTGATNC ACGCTGAGCT 
0361 CTGAGCTGAC CTACACCGAT CGGATCACTG CCATCCCGCT GGTCGCCAGC GGAGNAGNCA 
0421 CTGCCCGCCG AGGGATCGGA GNTGATCGTG GCCGGCTGAG GGACGCACCA GCGACGGCAC 
0481 CAACTCCTAC AAGATCCGTC AGNT 
 in silico PCR Fragment
0001 ATGCAGCCGA GACTAGTGAT TTTGGGTCTG ATCGGATTGA CGGCGGTGGG CATGTGCCAC 
0061 GCCCAGGGAC GCATCATGGG AGGGGAGGAC GCGGACGCCA CAGCCACGAC CTTCACCGCC 
0121 TCCTTGCGGG TGGACAATGC CCATGTGTGC GGCGGTAGCA TTCTCTCCCA GACCAAAATC 
0181 CTGACCACCG CCCACTGTGT GCATCGCGAT GGAAAGCTAA TCGATGCCAG TCGCCTGGCG 
0241 TGCCGCGTGG GCAG-TACCA ACCAGTATGC TGGTGGCAAG ATTGTCAACG TGGAATCGGT 
0301 TGCAGTGCAT CCGGACTACT ATAATCTGAA CAACAACCTG GCCGTGAT-C ACGCTGAGCT 
0361 CTGAGCTGAC CTACACCGAT CGGATCACTG CCATCCCGCT GGTCGCCAGC GGAG-AGGCA 
0421 CTGCCCGCCG AGGGATCGGA GGTGATCGTG GCCGGCTG-G GGACGCACCA GCGACGGCAC 
0481 CAACTCCTAC AAGATCCGTC AGAT 
 Assemble Data

9675R-3.IR_full       1   ATGCAGCCGAGACTAGTGATTTTGGNTCTGATCGGATTGACGGCGGTGGGCATGTGCCAC 60
                          ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||
9675R-3.in silico     1   ATGCAGCCGAGACTAGTGATTTTGGGTCTGATCGGATTGACGGCGGTGGGCATGTGCCAC 60


9675R-3.IR_full       61  GCCCAGGGACGCATCATGGGAGGGGAGGACGCGGACGCCACAGCCACGACCTTCACCGCC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9675R-3.in silico     61  GCCCAGGGACGCATCATGGGAGGGGAGGACGCGGACGCCACAGCCACGACCTTCACCGCC 120


9675R-3.IR_full       121 TCCTTGCGNGTGGACAATGCCCATGTGTGCGGCGGTAGCANTCTCTCCCAGACCAAAATC 180
                          |||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||
9675R-3.in silico     121 TCCTTGCGGGTGGACAATGCCCATGTGTGCGGCGGTAGCATTCTCTCCCAGACCAAAATC 180


9675R-3.IR_full       181 CTGACCACCGCCCACTGTGTGCATCGCGATGGAAAGCTAATCGATGCCAGTCGCCTGGCG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9675R-3.in silico     181 CTGACCACCGCCCACTGTGTGCATCGCGATGGAAAGCTAATCGATGCCAGTCGCCTGGCG 240


9675R-3.IR_full       241 TGCCGCGTGGGCAGNTACCAACCAGTATGCTGGTGGCAAGATTGTCAACGTGGAATCGGT 300
                          |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||
9675R-3.in silico     241 TGCCGCGTGGGCAG-TACCAACCAGTATGCTGGTGGCAAGATTGTCAACGTGGAATCGGT 300


9675R-3.IR_full       301 TGCAGTGCATCCGGACTACTATAATCTGAACAACAACCTGGCCGTGATNCACGCTGAGCT 360
                          |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
9675R-3.in silico     301 TGCAGTGCATCCGGACTACTATAATCTGAACAACAACCTGGCCGTGAT-CACGCTGAGCT 360


9675R-3.IR_full       361 CTGAGCTGACCTACACCGATCGGATCACTGCCATCCCGCTGGTCGCCAGCGGAGNAGNCA 420
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||
9675R-3.in silico     361 CTGAGCTGACCTACACCGATCGGATCACTGCCATCCCGCTGGTCGCCAGCGGAG-AGGCA 420


9675R-3.IR_full       421 CTGCCCGCCGAGGGATCGGAGNTGATCGTGGCCGGCTGAGGGACGCACCAGCGACGGCAC 480
                          ||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||
9675R-3.in silico     421 CTGCCCGCCGAGGGATCGGAGGTGATCGTGGCCGGCTG-GGGACGCACCAGCGACGGCAC 480


9675R-3.IR_full       481 CAACTCCTACAAGATCCGTCAGNT 504
                          |||||||||||||||||||||| |
9675R-3.in silico     481 CAACTCCTACAAGATCCGTCAGAT 504

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_132920.1  CG9675-RA (CG9675), mRNA 
0.2   NM_206487.1  CG33329-RB (CG33329), mRNA 
0   NM_132921.1  CG9673-RA (CG9673), mRNA 
0   11  NM_143287.1  CG5909-RA (CG5909), mRNA 
0   NM_166239.2  CG4878-RA, transcript variant A (eIF3-S9), mRNA 
0   NM_137384.2  CG4878-RB, transcript variant B (eIF3-S9), mRNA 
0   NM_139755.2  CG6467-RA (Jon65Aiv), mRNA 
0   NM_143523.1  CG15531-RA (CG15531), mRNA 
0   NM_133138.1  CG7884-RA (CG7884), mRNA 
0   NM_144288.1  CG12644-RA (CG12644), mRNA 
0   NM_140079.1  CG3280-RA (CG3280), mRNA 
0   NM_135861.1  CG15287-RA (CG15287), mRNA 
0   NM_138066.2  CG15873-RA (CG15873), mRNA 
0   NM_169155.1  CG1307-RB (CG1307), mRNA 
0   NM_141524.1  CG9626-RA (CG9626), mRNA 
0   NM_143543.2  CG18030-RA (Jon99Fi), mRNA 
0   NM_079830.2  CG31034-RA (Jon99Cii), mRNA 
0   NM_143542.1  CG2229-RA (Jon99Fii), mRNA 
0   NM_164594.1  CG3355-RB, transcript variant B (CG3355), mRNA 
0   NM_135004.1  CG3355-RA, transcript variant A (CG3355), mRNA 
0   NM_143527.2  CG9733-RA (CG9733), mRNA 
0   NM_079638.2  CG4920-RA (ea), mRNA 
0   NM_167913.1  CG7995-RC, transcript variant C (CG7995), mRNA 
0   NM_167915.1  CG7995-RE, transcript variant E (CG7995), mRNA 
0   NM_167914.1  CG7995-RD, transcript variant D (CG7995), mRNA 
0   NM_167912.1  CG7995-RB, transcript variant B (CG7995), mRNA 
0   NM_139398.1  CG7995-RA, transcript variant A (CG7995), mRNA 
0   NM_079614.2  CG7996-RA (snk), mRNA 
0   NM_141128.2  CG9063-RA (CG9063), mRNA 
0   NM_132923.2  CG9672-RA (CG9672), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.