National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9675R-2 
 Symbol spheroide  Full Name spheroide 
 CG No CG9675  Old CG No CG9675 
 Synonyms SPH114, anon-WO0140519.154, anon-EST:ParkEST153, spheroide, CG9675 
 Accession No (Link to NCBI) NM_132920.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr. Biol. (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| silico     1   ATGCAGCCGAGACTAGTGATTTTGGGTCTGATCGGATTGACGGCGGTGGGCATGTGCCAC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GCCCAGGGACGCATCATGGGAGGGGAGGACGCGGACGCCACAGCCACGACCTTCACCGCC 120

                          |||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||| silico     121 TCCTTGCGGGTGGACAATGCCCATGTGTGCGGCGGTAGCATTCTCTCCCAGACCAAAATC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CTGACCACCGCCCACTGTGTGCATCGCGATGGAAAGCTAATCGATGCCAGTCGCCTGGCG 240

                          |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| silico     241 TGCCGCGTGGGCAG-TACCAACCAGTATGCTGGTGGCAAGATTGTCAACGTGGAATCGGT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| silico     301 TGCAGTGCATCCGGACTACTATAATCTGAACAACAACCTGGCCGTGAT-CACGCTGAGCT 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||| || || silico     361 CTGAGCTGACCTACACCGATCGGATCACTGCCATCCCGCTGGTCGCCAGCGGAG-AGGCA 420

                          ||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||| silico     421 CTGCCCGCCGAGGGATCGGAGGTGATCGTGGCCGGCTG-GGGACGCACCAGCGACGGCAC 480

9675R-2.IR_full       481 CAACTCCTACAAGATCCGTCAGNT 504
                          |||||||||||||||||||||| | silico     481 CAACTCCTACAAGATCCGTCAGAT 504

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_132920.1  CG9675-RA (CG9675), mRNA 
0.2   NM_206487.1  CG33329-RB (CG33329), mRNA 
0   NM_132921.1  CG9673-RA (CG9673), mRNA 
0   11  NM_143287.1  CG5909-RA (CG5909), mRNA 
0   NM_166239.2  CG4878-RA, transcript variant A (eIF3-S9), mRNA 
0   NM_137384.2  CG4878-RB, transcript variant B (eIF3-S9), mRNA 
0   NM_139755.2  CG6467-RA (Jon65Aiv), mRNA 
0   NM_143523.1  CG15531-RA (CG15531), mRNA 
0   NM_133138.1  CG7884-RA (CG7884), mRNA 
0   NM_144288.1  CG12644-RA (CG12644), mRNA 
0   NM_140079.1  CG3280-RA (CG3280), mRNA 
0   NM_135861.1  CG15287-RA (CG15287), mRNA 
0   NM_138066.2  CG15873-RA (CG15873), mRNA 
0   NM_169155.1  CG1307-RB (CG1307), mRNA 
0   NM_141524.1  CG9626-RA (CG9626), mRNA 
0   NM_143543.2  CG18030-RA (Jon99Fi), mRNA 
0   NM_079830.2  CG31034-RA (Jon99Cii), mRNA 
0   NM_143542.1  CG2229-RA (Jon99Fii), mRNA 
0   NM_164594.1  CG3355-RB, transcript variant B (CG3355), mRNA 
0   NM_135004.1  CG3355-RA, transcript variant A (CG3355), mRNA 
0   NM_143527.2  CG9733-RA (CG9733), mRNA 
0   NM_079638.2  CG4920-RA (ea), mRNA 
0   NM_167913.1  CG7995-RC, transcript variant C (CG7995), mRNA 
0   NM_167915.1  CG7995-RE, transcript variant E (CG7995), mRNA 
0   NM_167914.1  CG7995-RD, transcript variant D (CG7995), mRNA 
0   NM_167912.1  CG7995-RB, transcript variant B (CG7995), mRNA 
0   NM_139398.1  CG7995-RA, transcript variant A (CG7995), mRNA 
0   NM_079614.2  CG7996-RA (snk), mRNA 
0   NM_141128.2  CG9063-RA (CG9063), mRNA 
0   NM_132923.2  CG9672-RA (CG9672), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.