National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9673R-1 
 Symbol CG9673  Full Name CG9673 
 CG No CG9673  Old CG No CG9673 
 Synonyms SPH81, CG9673 
 Accession No (Link to NCBI) NM_132921.1 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr. Biol. (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATTCTTGGCGGCGAGGACGTTGCCCAGGGCGAGTACCCCTGGTCCGCATCCGTGAGATAC 60

                          ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| silico     61  AACAAGGCCCACG-TCTGCTCCGGCGCCATCATCTCAACAAACCACATCCTGACCGCCGC 120

                          |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| silico     121 CCACTGTGTGTCCA-GCGTGGGCATCACCCCAGTGGATGCCAGCACCTTGGCTGTTCGCC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TGGGCACCATTAACCAGTACGCCGGCGGCAGCATTGTGAATGTAAAGAGCGTGATCATCC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ATCCATCGTACGGAAACTTCCTGCACGACATCGCCATACTGGAGCTGGACGAGACCCTGG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TCTTTAGCGATCGCATCCAAGACATCGCACTGCCCCCCACAACTGATGAGGAGACGGAAG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 ATGTGGACGCTGAGCTGCCCAACGGAACTCCGGTCTATGTGGCTGGATGGGGTGAACTTT 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CGGATGGTACTGCATCCTATAAACAGCAGAAGGCCAACTACAATACGCTGAGCCGATCCC 480

9673R-1.IR_full       481 TGTGCGAATGGGAAGCCGGATA 502
                          |||||||||||||||||||||| silico     481 TGTGCGAATGGGAAGCCGGATA 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_132921.1  CG9673-RA (CG9673), mRNA 
1.24   NM_143287.1  CG5909-RA (CG5909), mRNA 
0.2   NM_138066.2  CG15873-RA (CG15873), mRNA 
0.2   NM_079830.2  CG31034-RA (Jon99Cii), mRNA 
0.2   NM_143542.1  CG2229-RA (Jon99Fii), mRNA 
0.2   NM_143543.2  CG18030-RA (Jon99Fi), mRNA 
0   NM_132920.1  CG9675-RA (CG9675), mRNA 
0   13  NM_169868.1  CG31220-RA (CG31220), mRNA 
0   NM_140450.1  CG4613-RA (CG4613), mRNA 
0   NM_167161.1  CG2056-RB, transcript variant B (CG2056), mRNA 
0   NM_132264.2  CG2056-RA, transcript variant A (CG2056), mRNA 
0   NM_138238.1  CG13913-RA (CG13913), mRNA 
0   NM_135004.1  CG3355-RA, transcript variant A (CG3355), mRNA 
0   NM_164594.1  CG3355-RB, transcript variant B (CG3355), mRNA 
0   NM_079614.2  CG7996-RA (snk), mRNA 
0   NM_142086.2  CG9649-RA (CG9649), mRNA 
0   NM_170505.1  CG1539-RF, transcript variant F (tmod), mRNA 
0   NM_170503.1  CG1539-RD, transcript variant D (tmod), mRNA 
0   NM_170504.1  CG1539-RE, transcript variant E (tmod), mRNA 
0   NM_078969.3  CG12385-RA (thetaTry), mRNA 
0   NM_142054.1  CG14365-RA (CG14365), mRNA 
0   NM_133095.1  CG6891-RA, transcript variant A (CG6891), mRNA 
0   NM_166886.1  CG32808-RA (CG32808), mRNA 
0   NM_136265.2  CG17571-RA (CG17571), mRNA 
0   NM_132030.1  CG15770-RA (CG15770), mRNA 
0   NM_139590.2  CG1134-RA (CG1134), mRNA 
0   NM_079400.2  CG7659-RA (tap), mRNA 
0   NM_136257.2  CG8677-RA (CG8677), mRNA 
0   NM_057967.3  CG8729-RA, transcript variant A (rnh1), mRNA 
0   NM_206055.1  CG8729-RB, transcript variant B (rnh1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.