National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9672R-2 
 Symbol CG9672  Full Name CG9672 
 CG No CG9672  Old CG No CG9672 
 Synonyms SPH161, BcDNA:GH16384, CG9672 
 Accession No (Link to NCBI) NM_132923.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr. Biol. (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGAAGCTGACCCTCACCATTGGACTAATCCTTGTGGCCGCCGGAGTTCTGGAGGCCCAG 60

                          |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CCGCAGGGCAGGATCGCCGGTGGAGAAGATGCCGTTCTCGGCCAGCTGCCCTACCAGGCG 120

                          ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| silico     121 GCCCTCTCCATCGGCGGAAGCTACA-ACTGCGGCGCCGTGATCATTGGCCAGCGATACGC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CCTCACCGCCCTCTCTTGCGTCTGCTCCGACGGCAAGGATACCCCATGGGCTGCTGTTCT 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GTTCGCCGTGACCGTAGGATCGGTGGATCTCTACAATGGCAAGCAGATTCGCGTGGAGGA 300

                          ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| silico     301 GATCACCATTAACCCGAACTACAGCACTCTGAAGACCGGAATCGCCCTGCTCCGTCTGCA 360

                          ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| silico     361 GGAGGAGATTACTTTCAGTGAGACAGTCAATGCCATTCCACTCTCCCAGGA-CGTTCCGC 420

                           |||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| silico      421 CATGGGCA-GCCAGGTGGAGGTCTCCGG-CTGGGGCCGCACCACCGAGTCCGAGGTGAA 479

                          ||||||||||||||||||||||||| silico     481 CATGCATCGCACCCTGCAAATAGGA 504

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   483  NM_132923.2  CG9672-RA (CG9672), mRNA 
0   NM_140824.1  CG11619-RA (CG11619), mRNA 
0   NM_078523.2  CG2252-RB, transcript variant B (fs(1)h), mRNA 
0   NM_206645.1  CG2252-RE, transcript variant E (fs(1)h), mRNA 
0   NM_206646.1  CG2252-RD, transcript variant D (fs(1)h), mRNA 
0   NM_206647.1  CG2252-RC, transcript variant C (fs(1)h), mRNA 
0   NM_167144.2  CG2252-RA, transcript variant A (fs(1)h), mRNA 
0   NM_168353.1  CG32048-RB, transcript variant B (CG32048), mRNA 
0   NM_057546.2  CG3090-RA, transcript variant A (Sox14), mRNA 
0   NM_134290.1  CG3090-RB, transcript variant B (Sox14), mRNA 
0   NM_169905.1  CG5191-RD, transcript variant D (CG5191), mRNA 
0   NM_169903.1  CG5191-RE, transcript variant E (CG5191), mRNA 
0   NM_142636.1  CG5191-RB, transcript variant B (CG5191), mRNA 
0   NM_169902.1  CG5191-RC, transcript variant C (CG5191), mRNA 
0   NM_169904.1  CG5191-RA, transcript variant A (CG5191), mRNA 
0   NM_057873.4  CG3057-RA, transcript variant A (colt), mRNA 
0   NM_205896.1  CG3057-RB, transcript variant B (colt), mRNA 
0   NM_205895.1  CG3057-RC, transcript variant C (colt), mRNA 
0   NM_205894.1  CG3057-RD, transcript variant D (colt), mRNA 
0   NM_167495.1  CG9911-RD, transcript variant D (CG9911), mRNA 
0   NM_167496.1  CG9911-RC, transcript variant C (CG9911), mRNA 
0   NM_132883.2  CG9911-RA, transcript variant A (CG9911), mRNA 
0   NM_167494.1  CG9911-RB, transcript variant B (CG9911), mRNA 
0   NM_135589.2  CG17104-RA (CG17104), mRNA 
0   NM_079676.2  CG6009-RA (P5cr), mRNA 
0   NM_166679.1  CG30163-RA (CG30163), mRNA 
0   NM_165283.1  CG17567-RC, transcript variant C (CG17567), mRNA 
0   NM_144330.1  CG17567-RA, transcript variant A (CG17567), mRNA 
0   NM_165284.1  CG17567-RD, transcript variant D (CG17567), mRNA 
0   NM_165282.1  CG17567-RB, transcript variant B (CG17567), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.