National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9533R-1 
 Symbol rut  Full Name rutabaga 
 CG No CG9533  Old CG No CG9533 
 Synonyms CG9533, AC, Ac12F, unnamed, EP1603, rut 
 Accession No (Link to NCBI) NM_078601.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Palacios-Muñoz A, Ewer J.
Calcium and cAMP directly modulate the speed of the Drosophila circadian clock.
PLoS Genet. (2018) 14(6) e1007433 [ PubMed ID = 29879123 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TGGATCATGCCGTGAAGGCGACGCGCGGCCGCCCGTTGAATACGCTGCGCTTCGAGAACG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ATGAGCTGGAATGCCTCTACCAGCGGTATACGCTCAAGCTGCAGCGCTTCTCGGTGCTGG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GCGTGGTGGCTCTGGTCTTCGTCCTCTGCGGCGTGATGGCGGCCCTTTCGCTGACCTTCA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ACAACGCGGCCACCTTTCACAACATCTTCAATGCGATCGTTTGTGGACTGTTTGCCGTGG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TGCTGGTGCTGCTGCAGTGTTCCGTGATCAAGGACCACCACCTGCCCACATTGTGCTACG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GAATCCTGCTATTCACGGCCAGCATCTGTGTGGTGTCGATGCCCACATTGGGCAGCGTGT 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TCCCGGTGGACACCAAGGAGGTGATGGCCGAGGGCGTCTGGCAGATCGTGTTCGTGGTCT 420

                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || silico     421 TCCTCGCTTACGCCATGATGCCGCTGCAGATTTGGGAGGCGGTGGCCTTTGGCATCGCCC 480

9533R-1.IR_full       481 TGCCCTCGGTGCACATAAGT 500
                          |||||||||||||||||||| silico     481 TGCCCTCGGTGCACATAAGT 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  38  NM_078601.2  CG9533-RA (rut), mRNA 
1.03   10  NM_139854.1  CG8583-RA (sec63), mRNA 
0.62   45  NM_167685.1  CG12701-RB, transcript variant B (CG12701), mRNA 
0.62   45  NM_134512.4  CG12701-RA, transcript variant A (CG12701), mRNA 
0.41   16  NM_132908.2  CG4453-RA (Nup153), mRNA 
0   16  51  NM_134552.3  CG1412-RA (RhoGAP19D), mRNA 
0   76  NM_079903.2  CG15319-RB (nej), mRNA 
0   NM_136859.2  CG8991-RA (Sobp), mRNA 
0   NM_170430.2  CG31037-RA (ca), mRNA 
0   NM_206241.1  CG1275-RD, transcript variant D (CG1275), mRNA 
0   NM_167942.1  CG1275-RA, transcript variant A (CG1275), mRNA 
0   NM_167941.1  CG1275-RC, transcript variant C (CG1275), mRNA 
0   NM_139446.2  CG1275-RB, transcript variant B (CG1275), mRNA 
0   21  NM_168102.1  CG32239-RA (Gef64C), mRNA 
0   19  NM_130578.2  CG32809-RD, transcript variant D (CG32809), mRNA 
0   14  30  NM_167647.2  CG12199-RB, transcript variant B (kek5), mRNA 
0   14  30  NM_133154.2  CG12199-RA, transcript variant A (kek5), mRNA 
0   12  37  NM_080120.2  CG14560-RA (msopa), mRNA 
0   35  NM_079409.2  CG8127-RA, transcript variant A (Eip75B), mRNA 
0   18  NM_001014734.1  CG1522-RH, transcript variant H (cac), mRNA 
0   18  NM_078578.2  CG1522-RA, transcript variant A (cac), mRNA 
0   18  NM_206696.1  CG1522-RC, transcript variant C (cac), mRNA 
0   18  NM_001014733.1  CG1522-RI, transcript variant I (cac), mRNA 
0   18  NM_206694.1  CG1522-RE, transcript variant E (cac), mRNA 
0   18  NM_206697.1  CG1522-RB, transcript variant B (cac), mRNA 
0   18  NM_206693.1  CG1522-RF, transcript variant F (cac), mRNA 
0   18  NM_001014732.1  CG1522-RJ, transcript variant J (cac), mRNA 
0   18  NM_001014735.1  CG1522-RG, transcript variant G (cac), mRNA 
0   18  NM_206695.1  CG1522-RD, transcript variant D (cac), mRNA 
0   11  NM_132831.1  CG8184-RB (CG8184), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.