National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9491R-3 
 Symbol Gef26  Full Name Gef26 
 CG No CG9491  Old CG No CG9491 
 Synonyms GEF, CG9491, dizzy, l(2)k13720, Gef26, PDF-GEF Dizzy, dPDZ-GEF 
 Accession No (Link to NCBI) NM_135168.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Le Bras S, Rondanino C, Kriegel-Taki G, Dussert A, Le Borgne R.
Genetic identification of intracellular trafficking regulators involved in Notch-dependent binary cell fate acquisition following asymmetric cell division.
J. Cell. Sci. (2012) 125(Pt 20) 4886-901 [ PubMed ID = 22825875 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGTGGGCAGCTCGACTACAA 
 Primer Seq. 3'
aatctagaggtaccCATCTGCAGCTCTTCGCGACT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TGGTGGGCAG CTCGACTACA ATCAACCGGC CGGAACTGCA CCAAAAATGC AACCGGGGCT 
0061 CGCACTCCAG TGACACCAGT TCGGCGTACA GCGGCAGTGA TACAATGGCC TCGAACTATG 
0121 CCTCGTCGCT GGAGGCCGAG GAGATTGACC TCTCCGGCCT GGTGGAGTCC GTTGTGGACT 
0181 CTGACGAGGA GGACCTGGCG GAGAGCATGG ATAGTCTTAN CGTGCGGGAT GCCGTGCGTG 
0241 ACTGTCTGGA AAAGGATCCG GCGGAGCGCA GCGAGGAAGA TGTGGAAGTA CTGCTTGAGT 
0301 TCACGCAGGG CCTTAAGGCA TTCACAAACA TTACGCTGGC AGTGCGAAGA GCACTATGTT 
0361 CCGTGATGGT ATTCGCCGTT GTGGACAAGG CGGGAACCGT GGTCATGTCA GATGGTGAGG 
0421 AACTGGACTC ATGGTCGGTG CTCATAAACG GAGCGGTGGA GATCGAGCAT GCAAATGGCA 
0481 GTCGCGAAGA GCTGCAGATG  
 in silico PCR Fragment
0001 TGGTGGGCAG CTCGACTACA ATCAACCGGC CGGAACTGCA CCAAAAATGC AACCGGGGCT 
0061 CGCACTCCAG TGACACCAGT TCGGCGTACA GCGGCAGCGA TACAATGGCC TCGAACTATG 
0121 CCTCGTCGCT GGAGGCCGAG GAGATTGACC TCTCCGGCCT GGTGGAGTCC GTTGTGGACT 
0181 CTGACGAGGA GGACCTGGCG GAGAGCATGG ATAGTCTTAC CGTGCGGGAT GCCGTGCGTG 
0241 ACTGTCTGGA AAAGGATCCG GCGGAGCGCA GCGAGGAAGA TGTGGAAGTA CTGCTTGAGT 
0301 TCACGCAGGG CCTTAAGGCA TTCACAAACA TTACGCTGGC AGTGCGAAGA GCACTATGTT 
0361 CCGTGATGGT ATTCGCCGTT GTGGACAAGG CGGGAACCGT GGTCATGTCA GATGGTGAGG 
0421 AACTGGACTC ATGGTCGGTG CTCATAAACG GAGCGGTGGA GATCGAGCAT GCAAATGGCA 
0481 GTCGCGAAGA GCTGCAGATG  
 Assemble Data

9491R-3.IR_full       1   TGGTGGGCAGCTCGACTACAATCAACCGGCCGGAACTGCACCAAAAATGCAACCGGGGCT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9491R-3.in silico     1   TGGTGGGCAGCTCGACTACAATCAACCGGCCGGAACTGCACCAAAAATGCAACCGGGGCT 60


9491R-3.IR_full       61  CGCACTCCAGTGACACCAGTTCGGCGTACAGCGGCAGTGATACAATGGCCTCGAACTATG 120
                          ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
9491R-3.in silico     61  CGCACTCCAGTGACACCAGTTCGGCGTACAGCGGCAGCGATACAATGGCCTCGAACTATG 120


9491R-3.IR_full       121 CCTCGTCGCTGGAGGCCGAGGAGATTGACCTCTCCGGCCTGGTGGAGTCCGTTGTGGACT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9491R-3.in silico     121 CCTCGTCGCTGGAGGCCGAGGAGATTGACCTCTCCGGCCTGGTGGAGTCCGTTGTGGACT 180


9491R-3.IR_full       181 CTGACGAGGAGGACCTGGCGGAGAGCATGGATAGTCTTANCGTGCGGGATGCCGTGCGTG 240
                          ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
9491R-3.in silico     181 CTGACGAGGAGGACCTGGCGGAGAGCATGGATAGTCTTACCGTGCGGGATGCCGTGCGTG 240


9491R-3.IR_full       241 ACTGTCTGGAAAAGGATCCGGCGGAGCGCAGCGAGGAAGATGTGGAAGTACTGCTTGAGT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9491R-3.in silico     241 ACTGTCTGGAAAAGGATCCGGCGGAGCGCAGCGAGGAAGATGTGGAAGTACTGCTTGAGT 300


9491R-3.IR_full       301 TCACGCAGGGCCTTAAGGCATTCACAAACATTACGCTGGCAGTGCGAAGAGCACTATGTT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9491R-3.in silico     301 TCACGCAGGGCCTTAAGGCATTCACAAACATTACGCTGGCAGTGCGAAGAGCACTATGTT 360


9491R-3.IR_full       361 CCGTGATGGTATTCGCCGTTGTGGACAAGGCGGGAACCGTGGTCATGTCAGATGGTGAGG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9491R-3.in silico     361 CCGTGATGGTATTCGCCGTTGTGGACAAGGCGGGAACCGTGGTCATGTCAGATGGTGAGG 420


9491R-3.IR_full       421 AACTGGACTCATGGTCGGTGCTCATAAACGGAGCGGTGGAGATCGAGCATGCAAATGGCA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9491R-3.in silico     421 AACTGGACTCATGGTCGGTGCTCATAAACGGAGCGGTGGAGATCGAGCATGCAAATGGCA 480


9491R-3.IR_full       481 GTCGCGAAGAGCTGCAGATG 500
                          ||||||||||||||||||||
9491R-3.in silico     481 GTCGCGAAGAGCTGCAGATG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135168.3  CG9491-RA (Gef26), mRNA 
0   NM_139912.3  CG7574-RA (bip1), mRNA 
0   NM_078992.2  CG8581-RA, transcript variant A (fra), mRNA 
0   NM_165913.1  CG8581-RB, transcript variant B (fra), mRNA 
0   NM_079576.1  CG12809-RA (nerfin-2), mRNA 
0   NM_136727.2  CG18408-RA, transcript variant A (CAP), mRNA 
0   NM_132216.2  CG2116-RA (CG2116), mRNA 
0   NM_001015293.1  CG41114-PB.3 (CG41114), mRNA 
0   NM_137032.2  CG5970-RA (CG5970), mRNA 
0   NM_134981.2  CG3338-RA (CG3338), mRNA 
0   NM_169870.1  CG6184-RB, transcript variant B (CG6184), mRNA 
0   NM_142567.1  CG6184-RA, transcript variant A (CG6184), mRNA 
0   NM_132062.1  CG5921-RB, transcript variant B (CG5921), mRNA 
0   NM_167058.1  CG5921-RA, transcript variant A (CG5921), mRNA 
0   NM_165754.1  CG12214-RB, transcript variant B (CG12214), mRNA 
0   NM_136718.2  CG12214-RA, transcript variant A (CG12214), mRNA 
0   NM_164764.1  CG7052-RD, transcript variant D (TepII), mRNA 
0   NM_164763.1  CG7052-RE, transcript variant E (TepII), mRNA 
0   NM_164762.1  CG7052-RC, transcript variant C (TepII), mRNA 
0   NM_164761.1  CG7052-RB, transcript variant B (TepII), mRNA 
0   NM_078782.2  CG7052-RA, transcript variant A (TepII), mRNA 
0   NM_136255.1  CG8679-RA (CG8679), mRNA 
0   NM_130610.1  CG3600-RA (CG3600), mRNA 
0   NM_136643.2  CG8806-RA (prel), mRNA 
0   NM_137834.1  CG6018-RA (CG6018), mRNA 
0   NM_142448.2  CG8064-RA (CG8064), mRNA 
0   NM_132982.1  CG12996-RA (CG12996), mRNA 
0   NM_137807.2  CG5625-RA, transcript variant A (CG5625), mRNA 
0   NM_166518.1  CG5625-RB, transcript variant B (CG5625), mRNA 
0   NM_130669.2  CG2701-RA (CG2701), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.