National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9403R-1 
 Symbol jing  Full Name jing 
 CG No CG9397  Old CG No CG9403 
 Synonyms jing, 1.28, CT9093, CG9397, CG9403, l(2)01094, l(2)22F3 
 Accession No (Link to NCBI) NM_136371.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Kobayashi M, Michaut L, Ino A, Honjo K, Nakajima T, Maruyama Y, Mochizuki H, Ando M, Ghangrekar I, Takahashi K, Saigo K, Ueda R, Gehring WJ, Furukubo-Tokunaga K.
Differential microarray analysis of Drosophila mushroom body transcripts using chemical ablation.
Proc. Natl. Acad. Sci. U.S.A. (2006) 103(39) 14417-22 [ PubMed ID = 16971484 ] [ RRC reference ]

Kamimura K, Koyama T, Habuchi H, Ueda R, Masu M, Kimata K, Nakato H.
Specific and flexible roles of heparan sulfate modifications in Drosophila FGF signaling.
J. Cell Biol. (2006) 174(6) 773-8 [ PubMed ID = 16966419 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACAGTCATCTTAGCCAGCACA 
 Primer Seq. 3'
aatctagaggtaccCTTCTGCTCTTTCAGCTGCGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACAGTCATCT TNAGCCAGCA CAACGCAACC AGCGCCATGC CCAAGCCGAC CGACGCCTCA 
0061 GCGCCACGGC AACCCCAGCC TCCTTCCCAC GCTCCAGTGG CCGTGGAACA CCAGCCTGGG 
0121 CAGCACCTCC ACTGCCGTGC CCGCCGCCTC GGCCAACAAA AACAAGCGGA CGGCGGCCGG 
0181 ATCTGGAGCG GCATTAGGAT TGAGCGGTGA AGGGTCCTGT TTAACCGGTG GAGGAGCCGC 
0241 GTCGGCTAAG AAAGCGCGCA GCGATTTGCC CGGCTCCTTT GACGCAAGCA AAAGACTGAA 
0301 AGTGGCCGCT ATGGAGGAGT CACAGACCAA GATTACCGGT TTTTTTAAAT CCCAAATGAA 
0361 GCCGTCTCCT GGCGGCGGTA AgCTATCGCC GCAGCCCGGC CAGCAAAGTA ATCCGGCCAA 
0421 CACGCTGACC ATGAGCACAC CCGCAACTAC CGCCTCGCTG AACAAGTGCT TCAATATCCT 
0481 GTCGCAGCTG AAAGAGCAGA AG 
 in silico PCR Fragment
0001 ACAGTCATCT T-AGCCAGCA CAACGCAACC AGCGCCATGT CCAAGCCGA- CGACGCCTCA 
0061 GCGCCACGGC AACCCCAGCC TCCTTCCCAC GCTCCAGTGG CCGTGGAACA CCAGCCTGGG 
0121 CAGCACCTCC ACTGCCGTGC CCGCCGCCTC GGCCAACAAA AACAAGCGGA CGGCGGCCGG 
0181 ATCTGGAGCG GCATTAGGAT TGAGCGGTGA AGGGTCCTGT TTAACCGGTG GAGGAGCCGC 
0241 GTCGGCTAAG AAAGCGCGCA GCGATTTGCC CGGCTCCTTT GACGCAAGCA AAAGACTGAA 
0301 AGTGGCCGCT ATGGAGGAGT CACAGACCAA GATTACCGGT TTTTTTAAAT CCCAAATGAA 
0361 GCCGTCTCCT GGCGGCGGTA AGCTATCGCC GCAGCCCGGC CAGCAAAGCA ATCCGGCCAA 
0421 CACGCTGACC ATGAGCACGC CCGCAACTAC CGCCTCGCTG AACAAGTACT TCAATATCCT 
0481 GTCGCAGCTG AAAGAGCAGA AG 
 Assemble Data

9403R-1.IR_full       1   ACAGTCATCTTNAGCCAGCACAACGCAACCAGCGCCATGCCCAAGCCGACCGACGCCTCA 60
                          ||||||||||| ||||||||||||||||||||||||||| ||||||||| ||||||||||
9403R-1.in silico     1   ACAGTCATCTT-AGCCAGCACAACGCAACCAGCGCCATGTCCAAGCCGA-CGACGCCTCA 60


9403R-1.IR_full       61  GCGCCACGGCAACCCCAGCCTCCTTCCCACGCTCCAGTGGCCGTGGAACACCAGCCTGGG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9403R-1.in silico     61  GCGCCACGGCAACCCCAGCCTCCTTCCCACGCTCCAGTGGCCGTGGAACACCAGCCTGGG 120


9403R-1.IR_full       121 CAGCACCTCCACTGCCGTGCCCGCCGCCTCGGCCAACAAAAACAAGCGGACGGCGGCCGG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9403R-1.in silico     121 CAGCACCTCCACTGCCGTGCCCGCCGCCTCGGCCAACAAAAACAAGCGGACGGCGGCCGG 180


9403R-1.IR_full       181 ATCTGGAGCGGCATTAGGATTGAGCGGTGAAGGGTCCTGTTTAACCGGTGGAGGAGCCGC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9403R-1.in silico     181 ATCTGGAGCGGCATTAGGATTGAGCGGTGAAGGGTCCTGTTTAACCGGTGGAGGAGCCGC 240


9403R-1.IR_full       241 GTCGGCTAAGAAAGCGCGCAGCGATTTGCCCGGCTCCTTTGACGCAAGCAAAAGACTGAA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9403R-1.in silico     241 GTCGGCTAAGAAAGCGCGCAGCGATTTGCCCGGCTCCTTTGACGCAAGCAAAAGACTGAA 300


9403R-1.IR_full       301 AGTGGCCGCTATGGAGGAGTCACAGACCAAGATTACCGGTTTTTTTAAATCCCAAATGAA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9403R-1.in silico     301 AGTGGCCGCTATGGAGGAGTCACAGACCAAGATTACCGGTTTTTTTAAATCCCAAATGAA 360


9403R-1.IR_full       361 GCCGTCTCCTGGCGGCGGTAAGCTATCGCCGCAGCCCGGCCAGCAAAGTAATCCGGCCAA 420
                          |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||
9403R-1.in silico     361 GCCGTCTCCTGGCGGCGGTAAGCTATCGCCGCAGCCCGGCCAGCAAAGCAATCCGGCCAA 420


9403R-1.IR_full       421 CACGCTGACCATGAGCACACCCGCAACTACCGCCTCGCTGAACAAGTGCTTCAATATCCT 480
                          |||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||
9403R-1.in silico     421 CACGCTGACCATGAGCACGCCCGCAACTACCGCCTCGCTGAACAAGTACTTCAATATCCT 480


9403R-1.IR_full       481 GTCGCAGCTGAAAGAGCAGAAG 502
                          ||||||||||||||||||||||
9403R-1.in silico     481 GTCGCAGCTGAAAGAGCAGAAG 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_206026.1  CG9403-RC, transcript variant C (jing), mRNA 
100   482  NM_206027.1  CG9403-RD, transcript variant D (jing), mRNA 
100   482  NM_136371.2  CG9403-RA, transcript variant A (jing), mRNA 
0   NM_164556.1  CG10021-RA, transcript variant A (bowl), mRNA 
0   NM_164558.1  CG10021-RD, transcript variant D (bowl), mRNA 
0   NM_057535.2  CG10021-RC, transcript variant C (bowl), mRNA 
0   NM_164557.1  CG10021-RB, transcript variant B (bowl), mRNA 
0   NM_164617.1  CG4145-RC, transcript variant C (Cg25C), mRNA 
0   NM_164616.1  CG4145-RB, transcript variant B (Cg25C), mRNA 
0   NM_164615.1  CG4145-RA, transcript variant A (Cg25C), mRNA 
0   NM_080344.2  CG2890-RB, transcript variant B (PPP4R2r), mRNA 
0   NM_206677.1  CG2890-RC, transcript variant C (PPP4R2r), mRNA 
0   NM_167232.1  CG2890-RA, transcript variant A (PPP4R2r), mRNA 
0   NM_132521.2  CG1578-RA (CG1578), mRNA 
0   NM_140678.1  CG13023-RA (CG13023), mRNA 
0   NM_165344.1  CG9328-RB, transcript variant B (CG9328), mRNA 
0   NM_137477.2  CG5154-RA (Idgf5), mRNA 
0   NM_143106.2  CG10425-RA (CG10425), mRNA 
0   NM_079860.2  CG12073-RA (5-HT7), mRNA 
0   NM_057962.4  CG1782-RA (Uba1), mRNA 
0   NM_169970.1  CG6703-RA, transcript variant A (Caki), mRNA 
0   NM_206294.1  CG33275-RA, transcript variant A (CG33275), mRNA 
0   NM_206293.1  CG33275-RC, transcript variant C (CG33275), mRNA 
0   NM_206295.1  CG33275-RB, transcript variant B (CG33275), mRNA 
0   NM_001032399.1  CG33955-RB (eys), mRNA 
0   NM_142503.2  CG14291-RA (CG14291), mRNA 
0   NM_164944.1  CG31869-RA (CG31869), mRNA 
0   NM_206495.1  CG4898-RK, transcript variant K (Tm1), mRNA 
0   NM_134688.1  CG11835-RA (CG11835), mRNA 
0   NM_134895.2  CG3605-RA (CG3605), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.