National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9324R-2 
 Symbol Pomp  Full Name Pomp 
 CG No CG9324  Old CG No CG9324 
 Synonyms POMP, 38E.20, CG9324, Pomp 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   AGCCATCACTGAAAGTCCAGCCCGCCGAGGTGTCCGTGCTGAACGCCACCGGCCGTGTGG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GAATGCCCACCGAGGCCAACTGCCTGAACCAACTGGCCCACGTCCACCGGCTGCGCGACT 120

                          |||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||| silico     121 CGGAGCTGAACTACAACGAGCACCAGTACAACCGCAACATGCAGATGC-TGCGCAACCAC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GAGGGCCTCGGCGTGCCCCTCAAGATGGGCATGGAGCGCTTCGCCGCACGTCAGGTGGGC 240

                          ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| silico     241 CGCCTGCCCTTCCTTTCGTCCAGCAACTTCATGGACGATGTCCTGACTGGCCGCTGTGAT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TCCATTGGCTTCGAGGACTTCATGAACTTGCCCGAGAACAGCGAGCATATGCGTCAGCCC 360

                           |||||||||||||||||||||||||| silico     361 CACGCTGTGGTGGAGAAATCTCTGGGA 387

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  368  NM_136213.2  Pomp CG9324-RA (Pomp), mRNA 
0.27  NM_141876.1  CG12213-RB, transcript variant B (CG12213), mRNA 
0.27  NM_169442.1  CG12213-RA, transcript variant A (CG12213), mRNA 
NM_058133.3  ligatin CG31426-RA (ligatin), mRNA 
NM_136748.2  CG17765-RA (CG17765), mRNA 
NM_167687.1  CG11943-RB, transcript variant B (CG11943), mRNA 
NM_134518.2  CG11943-RA, transcript variant A (CG11943), mRNA 
NM_136869.2  CG13183-RA (CG13183), mRNA 
NM_135589.2  CG17104-RA (CG17104), mRNA 
NM_176316.1  Mocs1 CG33048-RC, transcript variant C (Mocs1), mRNA 
NM_176229.1  CG33147-RA (CG33147), mRNA 
10  NM_138033.1  CG13563-RA (CG13563), mRNA 
NM_078815.2  Leucine-rich repeat 47 CG6098-RA (Lrr47), mRNA 
NM_057943.3  miranda CG12249-RA, transcript variant A (mira), mRNA 
NM_057944.3  miranda CG12249-RB, transcript variant B (mira), mRNA 
NM_133090.1  CG6696-RA (CG6696), mRNA 
NM_079730.2  klingon CG6669-RA (klg), mRNA 
NM_132294.2  Anaphase Promoting Complex 4 CG32707-RA (APC4), mRNA 
NM_136455.1  CG2093-RA (CG2093), mRNA 
NM_137944.2  yellow-d2 CG9891-RA (yellow-d2), mRNA 
NM_057842.2  viking CG16858-RA (vkg), mRNA 
NM_080166.2  scattered CG3766-RA (scat), mRNA 
NM_139425.1  CG5691-RA (CG5691), mRNA 
NM_001042796.1  rugose CG6775-RC, transcript variant C (rg), mRNA 
NM_080023.1  rugose CG6775-RA, transcript variant A (rg), mRNA 
NM_167028.1  rugose CG6775-RB, transcript variant B (rg), mRNA 
NM_170524.1  warts CG12072-RA (wts), mRNA 
NM_169228.1  CG31258-RA (CG31258), mRNA 
NM_170415.2  CG31041-RA (CG31041), mRNA 
NM_167371.1  CG32635-RA (CG32635), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.