National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9323R-4 
 Symbol CG9323  Full Name CG9323 
 CG No CG9323  Old CG No CG9323 
 Synonyms 38E.15, cg9323, CG9323 
 Accession No (Link to NCBI) NM_136212.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| silico     1   CCCCAAGCTGGACGAGAGACTGCAGCTGGAACTGGGGCAACGCCAGTTGGAGGAGAATGC 60

                          |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| silico     61  CAAGAAACGGCTAGAAGCACGGAAAAAACTGCCCACCATGAAATACGCCGACGATATTAT 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CCAGGCTGTGCGGGAAAACCAAGTAATACTCATTGTAGGAAGCACTGGATGTGGCAAGAC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CACTCAGGTGCCTCAAATCCTCCTCGACGACGCCATTTCCCGCGGATGTGCCTCGTCGTG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CCGCATCATTTGCACTCAGCCACGAAGGATTTCAGCCATCGCCATTGCCGAGTGGGTGAG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TTACGAGCGCTGCGAGAGCCTGGGCAATTCGGTAGGCTACCAGATTCGCCTAGAGAGCAG 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GAAGGCCAGGGAGAGAGCCTCCATCACTTACTGCACCACAGGCGTTCTACTGCAGCAGCT 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TCAATCGGACCCACTGATGCACAATCTAAGTGTCTTAATCCTGGATGAGATCCACGAACG 480

9323R-4.IR_full       481 CAGCGTGGAAACAGATCTCC 500
                          |||||||||||||||||||| silico     481 CAGCGTGGAAACAGATCTCC 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136212.1  CG9323-RA (CG9323), mRNA 
0   10  NM_057393.3  CG3158-RA (spn-E), mRNA 
0   NM_168751.1  CG32188-RA (CG32188), mRNA 
0   NM_168752.1  CG32189-RA (CG32189), mRNA 
0   NM_144343.2  CG8250-RA (Alk), mRNA 
0   NM_143371.1  CG9990-RA, transcript variant A (CG9990), mRNA 
0   NM_170376.1  CG9990-RB, transcript variant B (CG9990), mRNA 
0   NM_143997.2  CG14545-RA (CG14545), mRNA 
0   NM_166367.1  CG30130-RA (CG30130), mRNA 
0   NM_001031986.1  CG33719-RB, transcript variant B (Pif1A), mRNA 
0   NM_134551.4  CG32506-RA (CG32506), mRNA 
0   NM_001031985.1  CG33720-RA, transcript variant A (Pif1B), mRNA 
0   NM_001031987.1  CG33719-RA, transcript variant A (Pif1A), mRNA 
0   NM_079106.2  CG4817-RA (Ssrp), mRNA 
0   NM_164411.2  CG4896-RB, transcript variant B (CG4896), mRNA 
0   NM_134739.5  CG4896-RD, transcript variant D (CG4896), mRNA 
0   NM_164409.2  CG4896-RC, transcript variant C (CG4896), mRNA 
0   NM_164410.2  CG4896-RA, transcript variant A (CG4896), mRNA 
0   NM_138003.2  CG5591-RA (CG5591), mRNA 
0   NM_166844.1  CG17896-RA, transcript variant A (CG17896), mRNA 
0   NM_130489.2  CG17896-RB, transcript variant B (CG17896), mRNA 
0   NM_136775.2  CG12344-RA (CG12344), mRNA 
0   NM_131948.1  CG3081-RA (CG3081), mRNA 
0   NM_135786.1  CG6108-RA (CG6108), mRNA 
0   NM_143157.1  CG5039-RA (CG5039), mRNA 
0   NM_167233.1  CG32687-RA (CG32687), mRNA 
0   NM_140972.2  CG5932-RA (CG5932), mRNA 
0   10  NM_166125.2  CG18255-RA, transcript variant A (Strn-Mlck), mRNA 
0   NM_166126.1  CG18255-RC, transcript variant C (Strn-Mlck), mRNA 
0   NM_166127.1  CG18255-RF, transcript variant F (Strn-Mlck), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.