National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9320R-1 
 Symbol CG9320  Full Name CG9320 
 CG No CG9320  Old CG No CG9320 
 Synonyms 38E.14, CG9320 
 Accession No (Link to NCBI) NM_136211.3 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGTGGCCTTTAGCGGCAAGAA 
 Primer Seq. 3'
aatctagaggtaccAGAACTCCAGGACACGCCATA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGTGGCCTTT AGCGGCAAGA AGAAGAAGGA CCAGATGTTG CAAAAgCGCA ACACAAAAGG 
0061 TCCCCCAAAG TATCTGAGGA GCACGCAGGA GTCGTATGAG GACAGCGATG TGCCGGAAAC 
0121 GACCAGGAAA CTCATGGAGC AGCCTTTTGC GCGCGGCGGA AACCGAAACA AGAACGTCAA 
0181 TCGCTATAAT TTGCAATTCT ACCAGGAGGG CAAAAAGGAA CTGGAGCAAA TGAAACAAGA 
0241 GGGCTTTAAA CCGTTCGAGA AACTCAGTCC CGCTCAGCGG GAAGTGGACG ACCGATACTT 
0301 TGCCGGCTGC GACTTCCCAG TTCGTCCACC TTGGACGCTA ACGGAGTCCA AGGAAGAGCT 
0361 TGATCGCACC GAGAATCGCT ACTTTAAGGA ATACGTGGAC GAGCTGCAGA AAAAGCAGCG 
0421 TGCTGGAGAT TCGAAGGAGC TTTCGCTGTT TGAGCTGAAT CTGGAAACCT GGCGTCAGCT 
0481 ATGGCGTGTC CTGGAGTTCT  
 in silico PCR Fragment
0001 GGTGGCCTTT AGCGGCAAGA AGAAGAAGGA CCAGATGTTG CAAAAGCGCA ACACAAAAGG 
0061 TCCCCCAAAG TATCTGAGGA GCACGCAGGA GTCGTATGAG GACAGCGATG TGCCGGAAAC 
0121 GACCAGGAAA CTCATGGAGC AGCCTTTTGC GCGCGGCGGA AACCGAAACA AGAACGTCAA 
0181 TCGCTATAAT TTGCAATTCT ACCAGGAGGG CAAAAAGGAA CTGGAGCAAA TGAAACAAGA 
0241 GGGCTTTAAA CCGTTCGAGA AACTCAGTCC CGCTCAGCGG GAAGTGGACG ACCGATACTT 
0301 TGCCGGCTGC GACTTCCCAG TTCGTCCACC TTGGACGCTA ACGGAGTCCA AGGAAGAGCT 
0361 TGATCGCACC GAGAATCGCT ACTTTAAGGA ATACGTGGAC GAGCTGCAGA AAAAGCAGCG 
0421 TGCTGGAGAT TCGAAGGAGC TTTCGCTGTT TGAGCTGAAT CTGGAAACCT GGCGTCAGCT 
0481 ATGGCGTGTC CTGGAGTTCT  
 Assemble Data

9320R-1.IR_full       1   GGTGGCCTTTAGCGGCAAGAAGAAGAAGGACCAGATGTTGCAAAAGCGCAACACAAAAGG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9320R-1.in silico     1   GGTGGCCTTTAGCGGCAAGAAGAAGAAGGACCAGATGTTGCAAAAGCGCAACACAAAAGG 60


9320R-1.IR_full       61  TCCCCCAAAGTATCTGAGGAGCACGCAGGAGTCGTATGAGGACAGCGATGTGCCGGAAAC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9320R-1.in silico     61  TCCCCCAAAGTATCTGAGGAGCACGCAGGAGTCGTATGAGGACAGCGATGTGCCGGAAAC 120


9320R-1.IR_full       121 GACCAGGAAACTCATGGAGCAGCCTTTTGCGCGCGGCGGAAACCGAAACAAGAACGTCAA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9320R-1.in silico     121 GACCAGGAAACTCATGGAGCAGCCTTTTGCGCGCGGCGGAAACCGAAACAAGAACGTCAA 180


9320R-1.IR_full       181 TCGCTATAATTTGCAATTCTACCAGGAGGGCAAAAAGGAACTGGAGCAAATGAAACAAGA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9320R-1.in silico     181 TCGCTATAATTTGCAATTCTACCAGGAGGGCAAAAAGGAACTGGAGCAAATGAAACAAGA 240


9320R-1.IR_full       241 GGGCTTTAAACCGTTCGAGAAACTCAGTCCCGCTCAGCGGGAAGTGGACGACCGATACTT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9320R-1.in silico     241 GGGCTTTAAACCGTTCGAGAAACTCAGTCCCGCTCAGCGGGAAGTGGACGACCGATACTT 300


9320R-1.IR_full       301 TGCCGGCTGCGACTTCCCAGTTCGTCCACCTTGGACGCTAACGGAGTCCAAGGAAGAGCT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9320R-1.in silico     301 TGCCGGCTGCGACTTCCCAGTTCGTCCACCTTGGACGCTAACGGAGTCCAAGGAAGAGCT 360


9320R-1.IR_full       361 TGATCGCACCGAGAATCGCTACTTTAAGGAATACGTGGACGAGCTGCAGAAAAAGCAGCG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9320R-1.in silico     361 TGATCGCACCGAGAATCGCTACTTTAAGGAATACGTGGACGAGCTGCAGAAAAAGCAGCG 420


9320R-1.IR_full       421 TGCTGGAGATTCGAAGGAGCTTTCGCTGTTTGAGCTGAATCTGGAAACCTGGCGTCAGCT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9320R-1.in silico     421 TGCTGGAGATTCGAAGGAGCTTTCGCTGTTTGAGCTGAATCTGGAAACCTGGCGTCAGCT 480


9320R-1.IR_full       481 ATGGCGTGTCCTGGAGTTCT 500
                          ||||||||||||||||||||
9320R-1.in silico     481 ATGGCGTGTCCTGGAGTTCT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136211.3  CG9320-RA (CG9320), mRNA 
0   NM_168144.1  CG32409-RA (CG32409), mRNA 
0   NM_135873.2  CG12636-RA (CG12636), mRNA 
0   NM_079000.2  CG3879-RA (Mdr49), mRNA 
0   NM_001031980.1  CG9638-RB, transcript variant B (Ada2b), mRNA 
0   NM_141516.2  CG9638-RA, transcript variant A (Ada2b), mRNA 
0   NM_136651.1  CG1888-RA (CG1888), mRNA 
0   NM_001038869.1  CG33958-RA (CG33958), mRNA 
0   NM_176436.1  CG8176-RB, transcript variant B (CG8176), mRNA 
0   NM_176435.1  CG8176-RA, transcript variant A (CG8176), mRNA 
0   14  NM_169883.1  CG4836-RA, transcript variant A (CG4836), mRNA 
0   14  NM_142599.1  CG4836-RC, transcript variant C (CG4836), mRNA 
0   13  NM_169882.1  CG4836-RB, transcript variant B (CG4836), mRNA 
0   NM_143300.1  CG3339-RA, transcript variant A (CG3339), mRNA 
0   NM_001043297.1  CG3339-RB, transcript variant B (CG3339), mRNA 
0   NM_078924.3  CG12165-RA (Incenp), mRNA 
0   NM_143522.2  CG9747-RA (CG9747), mRNA 
0   NM_170184.1  CG6238-RB, transcript variant B (ssh), mRNA 
0   NM_079768.2  CG6238-RA, transcript variant A (ssh), mRNA 
0   NM_139541.1  CG12017-RA (CG12017), mRNA 
0   NM_142269.1  CG8925-RA (CG8925), mRNA 
0   NM_057837.3  CG1616-RA (dpa), mRNA 
0   NM_169090.1  CG2182-RB, transcript variant B (CG2182), mRNA 
0   NM_141313.1  CG2182-RA, transcript variant A (CG2182), mRNA 
0   NM_137134.2  CG12861-RA (CG12861), mRNA 
0   14  49  NM_137093.4  CG30069-RA (CG30069), mRNA 
0   NM_144347.2  CG12149-RA (c12.2), mRNA 
0   NM_078776.4  CG31629-RA, transcript variant A (Pvf3), mRNA 
0   NM_143132.2  CG11902-RA (CG11902), mRNA 
0   10  NM_137150.2  CG10209-RA (CG10209), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.