National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock temporarily unavailable request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9320R-1 
 Symbol CG9320  Full Name CG9320 
 CG No CG9320  Old CG No CG9320 
 Synonyms 38E.14, CG9320 
 Accession No (Link to NCBI) NM_136211.3 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GGTGGCCTTTAGCGGCAAGAAGAAGAAGGACCAGATGTTGCAAAAGCGCAACACAAAAGG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TCCCCCAAAGTATCTGAGGAGCACGCAGGAGTCGTATGAGGACAGCGATGTGCCGGAAAC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GACCAGGAAACTCATGGAGCAGCCTTTTGCGCGCGGCGGAAACCGAAACAAGAACGTCAA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TCGCTATAATTTGCAATTCTACCAGGAGGGCAAAAAGGAACTGGAGCAAATGAAACAAGA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GGGCTTTAAACCGTTCGAGAAACTCAGTCCCGCTCAGCGGGAAGTGGACGACCGATACTT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TGCCGGCTGCGACTTCCCAGTTCGTCCACCTTGGACGCTAACGGAGTCCAAGGAAGAGCT 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TGATCGCACCGAGAATCGCTACTTTAAGGAATACGTGGACGAGCTGCAGAAAAAGCAGCG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TGCTGGAGATTCGAAGGAGCTTTCGCTGTTTGAGCTGAATCTGGAAACCTGGCGTCAGCT 480

9320R-1.IR_full       481 ATGGCGTGTCCTGGAGTTCT 500
                          |||||||||||||||||||| silico     481 ATGGCGTGTCCTGGAGTTCT 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136211.3  CG9320-RA (CG9320), mRNA 
0   NM_168144.1  CG32409-RA (CG32409), mRNA 
0   NM_135873.2  CG12636-RA (CG12636), mRNA 
0   NM_079000.2  CG3879-RA (Mdr49), mRNA 
0   NM_001031980.1  CG9638-RB, transcript variant B (Ada2b), mRNA 
0   NM_141516.2  CG9638-RA, transcript variant A (Ada2b), mRNA 
0   NM_136651.1  CG1888-RA (CG1888), mRNA 
0   NM_001038869.1  CG33958-RA (CG33958), mRNA 
0   NM_176436.1  CG8176-RB, transcript variant B (CG8176), mRNA 
0   NM_176435.1  CG8176-RA, transcript variant A (CG8176), mRNA 
0   14  NM_169883.1  CG4836-RA, transcript variant A (CG4836), mRNA 
0   14  NM_142599.1  CG4836-RC, transcript variant C (CG4836), mRNA 
0   13  NM_169882.1  CG4836-RB, transcript variant B (CG4836), mRNA 
0   NM_143300.1  CG3339-RA, transcript variant A (CG3339), mRNA 
0   NM_001043297.1  CG3339-RB, transcript variant B (CG3339), mRNA 
0   NM_078924.3  CG12165-RA (Incenp), mRNA 
0   NM_143522.2  CG9747-RA (CG9747), mRNA 
0   NM_170184.1  CG6238-RB, transcript variant B (ssh), mRNA 
0   NM_079768.2  CG6238-RA, transcript variant A (ssh), mRNA 
0   NM_139541.1  CG12017-RA (CG12017), mRNA 
0   NM_142269.1  CG8925-RA (CG8925), mRNA 
0   NM_057837.3  CG1616-RA (dpa), mRNA 
0   NM_169090.1  CG2182-RB, transcript variant B (CG2182), mRNA 
0   NM_141313.1  CG2182-RA, transcript variant A (CG2182), mRNA 
0   NM_137134.2  CG12861-RA (CG12861), mRNA 
0   14  49  NM_137093.4  CG30069-RA (CG30069), mRNA 
0   NM_144347.2  CG12149-RA (c12.2), mRNA 
0   NM_078776.4  CG31629-RA, transcript variant A (Pvf3), mRNA 
0   NM_143132.2  CG11902-RA (CG11902), mRNA 
0   10  NM_137150.2  CG10209-RA (CG10209), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.