National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9319R-3 
 Symbol CG9319  Full Name CG9319 
 CG No CG9319  Old CG No CG9319 
 Synonyms 38E.13, CG9319 
 Accession No (Link to NCBI) NM_136210.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGCCACTTAAAGGCATCAGG 
 Primer Seq. 3'
aatctagaggtaccAGGGCAAGGCAAATTCCCAGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ATGCCACTTA AAGGCATCAG GGTACTCGAA TTCGTGGGTT TAGCACCAGG ACCGTTTTGT 
0061 GGGAAGATTC TAACCGACTT TGGGGCCACA GTCACCCGCA TCGACAAGGT GATAGAAAAC 
0121 CCTTTGGATG TACTGCAGCA GGGAAAGCGC ACACTTTGCC TGGATCTGAA GAACCCGAAA 
0181 GGTCAGCAAG CGGTGCAAAG GCTGGTCAAG AAGTGCGATG TGCTCATCGA ACCTTTTCGA 
0241 CCGGGAGTAA TGGAGAAACT AAATCTGGGT CCCACCGACT TGTGCACAGC CAATCCCCGC 
0301 CTGATTTATG CCCGCCTCAC CGGCTTTGGC CAGCATGGAA GACTGGCGCA ACGGGCGGGA 
0361 CACGACATCA ACTACGCGGC CTTATCGGGA GTACTTTCCA TGCTGGGCAG GCGCCACGAA 
0421 AAGGTCACTG CACCCATTAA TATTCTGGCC GATTTCGCTG GCGGCAGTTT GATGTGCGCT 
0481 CTGGGAATTT GCCTTGCCCT  
 in silico PCR Fragment
0001 ATGCCACTTA AAGGCATCAG GGTACTCGAA TTCGTGGGTT TAGCACCAGG ACCGTTTTGT 
0061 GGGAAGATTC TAACCGACTT TGGGGCCACA GTCACCCGCA TCGACAAGGT GATGGAAAAC 
0121 CCTTTGGATG TACTGCAGCA GGGAAAGCGC ACACTTTGCC TGGATCTGAA GAACCCGAAA 
0181 GGTCAGCAAG CGGTGCAAAG GCTGGTCAAG AAGTGCGATG TGCTCATCGA ACCTTTTCGA 
0241 CCGGGAGTAA TGGAGAAACT AAATCTGGGT CCCACCGACT TGTGCACAGC CAATCCCCGC 
0301 CTGATTTATG CCCGCCTCAC CGGCTTTGGC CAGCATGGAA GACTGGCGCA ACGGGCGGGA 
0361 CACGACATCA ACTACGCGGC CTTATCGGGA GTACTTTCCA TGCTGGGCAG GCGCCACGAA 
0421 AAGGTCACTG CACCCATTAA TATTCTGGCC GATTTCGCTG GCGGCAGTTT GATGTGCGCT 
0481 CTGGGAATTT GCCTTGCCCT  
 Assemble Data

9319R-3.IR_full       1   ATGCCACTTAAAGGCATCAGGGTACTCGAATTCGTGGGTTTAGCACCAGGACCGTTTTGT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9319R-3.in silico     1   ATGCCACTTAAAGGCATCAGGGTACTCGAATTCGTGGGTTTAGCACCAGGACCGTTTTGT 60


9319R-3.IR_full       61  GGGAAGATTCTAACCGACTTTGGGGCCACAGTCACCCGCATCGACAAGGTGATAGAAAAC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
9319R-3.in silico     61  GGGAAGATTCTAACCGACTTTGGGGCCACAGTCACCCGCATCGACAAGGTGATGGAAAAC 120


9319R-3.IR_full       121 CCTTTGGATGTACTGCAGCAGGGAAAGCGCACACTTTGCCTGGATCTGAAGAACCCGAAA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9319R-3.in silico     121 CCTTTGGATGTACTGCAGCAGGGAAAGCGCACACTTTGCCTGGATCTGAAGAACCCGAAA 180


9319R-3.IR_full       181 GGTCAGCAAGCGGTGCAAAGGCTGGTCAAGAAGTGCGATGTGCTCATCGAACCTTTTCGA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9319R-3.in silico     181 GGTCAGCAAGCGGTGCAAAGGCTGGTCAAGAAGTGCGATGTGCTCATCGAACCTTTTCGA 240


9319R-3.IR_full       241 CCGGGAGTAATGGAGAAACTAAATCTGGGTCCCACCGACTTGTGCACAGCCAATCCCCGC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9319R-3.in silico     241 CCGGGAGTAATGGAGAAACTAAATCTGGGTCCCACCGACTTGTGCACAGCCAATCCCCGC 300


9319R-3.IR_full       301 CTGATTTATGCCCGCCTCACCGGCTTTGGCCAGCATGGAAGACTGGCGCAACGGGCGGGA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9319R-3.in silico     301 CTGATTTATGCCCGCCTCACCGGCTTTGGCCAGCATGGAAGACTGGCGCAACGGGCGGGA 360


9319R-3.IR_full       361 CACGACATCAACTACGCGGCCTTATCGGGAGTACTTTCCATGCTGGGCAGGCGCCACGAA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9319R-3.in silico     361 CACGACATCAACTACGCGGCCTTATCGGGAGTACTTTCCATGCTGGGCAGGCGCCACGAA 420


9319R-3.IR_full       421 AAGGTCACTGCACCCATTAATATTCTGGCCGATTTCGCTGGCGGCAGTTTGATGTGCGCT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9319R-3.in silico     421 AAGGTCACTGCACCCATTAATATTCTGGCCGATTTCGCTGGCGGCAGTTTGATGTGCGCT 480


9319R-3.IR_full       481 CTGGGAATTTGCCTTGCCCT 500
                          ||||||||||||||||||||
9319R-3.in silico     481 CTGGGAATTTGCCTTGCCCT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136210.1  CG9319-RA (CG9319), mRNA 
0   NM_143006.1  CG13617-RA (CG13617), mRNA 
0   NM_135180.1  CG9511-RA (CG9511), mRNA 
0   NM_133085.2  CG6606-RA (l(1)G0003), mRNA 
0   NM_132089.3  CG3847-RA (CG3847), mRNA 
0   NM_132048.1  CG4020-RA (CG4020), mRNA 
0   NM_139854.1  CG8583-RA (sec63), mRNA 
0   NM_141946.2  CG18549-RA (CG18549), mRNA 
0   NM_164436.1  CG17646-RB, transcript variant B (CG17646), mRNA 
0   NM_134774.2  CG17646-RA, transcript variant A (CG17646), mRNA 
0   NM_169701.2  CG31045-RB, transcript variant B (Mhcl), mRNA 
0   NM_143284.2  CG6059-RA (CG6059), mRNA 
0   NM_168165.2  CG32403-RA (Or65c), mRNA 
0   NM_142385.1  CG14322-RA (CG14322), mRNA 
0   NM_136473.2  CG1941-RA (CG1941), mRNA 
0   NM_141297.1  CG2926-RA (CG2926), mRNA 
0   NM_166130.1  CG18255-RE, transcript variant E (Strn-Mlck), mRNA 
0   NM_166126.1  CG18255-RC, transcript variant C (Strn-Mlck), mRNA 
0   NM_080190.2  CG4152-RA (l(2)35Df), mRNA 
0   NM_140561.3  CG5931-RA (CG5931), mRNA 
0   NM_137340.2  CG8950-RA (CG8950), mRNA 
0   NM_057969.3  CG9635-RD, transcript variant D (RhoGEF2), mRNA 
0   NM_206147.1  CG9635-RE, transcript variant E (RhoGEF2), mRNA 
0   NM_206146.1  CG9635-RF, transcript variant F (RhoGEF2), mRNA 
0   NM_135604.2  CG12299-RA (CG12299), mRNA 
0   12  NM_165673.1  CG1968-RA, transcript variant A (CG1968), mRNA 
0   12  NM_136632.2  CG1968-RB, transcript variant B (CG1968), mRNA 
0   NM_137959.1  CG5360-RA (CG5360), mRNA 
0   NM_142411.1  CG12347-RA (CG12347), mRNA 
0   NM_167564.1  CG8649-RC, transcript variant C (Fim), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.