National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9319R-2 
 Symbol CG9319  Full Name CG9319 
 CG No CG9319  Old CG No CG9319 
 Synonyms 38E.13, CG9319 
 Accession No (Link to NCBI) NM_136210.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ATGCCACTTAAAGGCATCAGGGTACTCGAATTCGTGGGTTTAGCACCAGGACCGTTTTGT 60

                          ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| silico     61  GGGAAGATTCTAACCGACTTTGGGGCCACAGTCACCCGCATCGACAAGGTGATGGAAAAC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CCTTTGGATGTACTGCAGCAGGGAAAGCGCACACTTTGCCTGGATCTGAAGAACCCGAAA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GGTCAGCAAGCGGTGCAAAGGCTGGTCAAGAAGTGCGATGTGCTCATCGAACCTTTTCGA 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CCGGGAGTAATGGAGAAACTAAATCTGGGTCCCACCGACTTGTGCACAGCCAATCCCCGC 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CTGATTTATGCCCGCCTCACCGGCTTTGGCCAGCATGGAAGACTGGCGCAACGGGCGGGA 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CACGACATCAACTACGCGGCCTTATCGGGAGTACTTTCCATGCTGGGCAGGCGCCACGAA 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AAGGTCACTGCACCCATTAATATTCTGGCCGATTTCGCTGGCGGCAGTTTGATGTGCGCT 480

9319R-2.IR_full       481 CTGGGAATTTGCCTTGCCCT 500
                          |||||||||||||||||||| silico     481 CTGGGAATTTGCCTTGCCCT 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_136210.1  CG9319-RA (CG9319), mRNA 
0   NM_143006.1  CG13617-RA (CG13617), mRNA 
0   NM_135180.1  CG9511-RA (CG9511), mRNA 
0   NM_133085.2  CG6606-RA (l(1)G0003), mRNA 
0   NM_132089.3  CG3847-RA (CG3847), mRNA 
0   NM_132048.1  CG4020-RA (CG4020), mRNA 
0   NM_139854.1  CG8583-RA (sec63), mRNA 
0   NM_141946.2  CG18549-RA (CG18549), mRNA 
0   NM_164436.1  CG17646-RB, transcript variant B (CG17646), mRNA 
0   NM_134774.2  CG17646-RA, transcript variant A (CG17646), mRNA 
0   NM_169701.2  CG31045-RB, transcript variant B (Mhcl), mRNA 
0   NM_143284.2  CG6059-RA (CG6059), mRNA 
0   NM_168165.2  CG32403-RA (Or65c), mRNA 
0   NM_142385.1  CG14322-RA (CG14322), mRNA 
0   NM_136473.2  CG1941-RA (CG1941), mRNA 
0   NM_141297.1  CG2926-RA (CG2926), mRNA 
0   NM_166130.1  CG18255-RE, transcript variant E (Strn-Mlck), mRNA 
0   NM_166126.1  CG18255-RC, transcript variant C (Strn-Mlck), mRNA 
0   NM_080190.2  CG4152-RA (l(2)35Df), mRNA 
0   NM_140561.3  CG5931-RA (CG5931), mRNA 
0   NM_137340.2  CG8950-RA (CG8950), mRNA 
0   NM_057969.3  CG9635-RD, transcript variant D (RhoGEF2), mRNA 
0   NM_206147.1  CG9635-RE, transcript variant E (RhoGEF2), mRNA 
0   NM_206146.1  CG9635-RF, transcript variant F (RhoGEF2), mRNA 
0   NM_135604.2  CG12299-RA (CG12299), mRNA 
0   12  NM_165673.1  CG1968-RA, transcript variant A (CG1968), mRNA 
0   12  NM_136632.2  CG1968-RB, transcript variant B (CG1968), mRNA 
0   NM_137959.1  CG5360-RA (CG5360), mRNA 
0   NM_142411.1  CG12347-RA (CG12347), mRNA 
0   NM_167564.1  CG8649-RC, transcript variant C (Fim), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.