National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9232R-2 
 Symbol CG9232  Full Name CG9232 
 CG No CG9232  Old CG No CG9232 
 Synonyms CG9232 
 Accession No (Link to NCBI) NM_135218.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGGCCAATGGGTCCTAGTGTG 
 Primer Seq. 3'
aatctagaggtaccGCTCCTGCTTCAGTTGCGGTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGGCCAANTG GGTCCTAGTG TGCCCACATC GCACCCAACG CCCTTGGTCG GGTCAGCAGG 
0061 AGAAGGCGCA GAAGAACGAG CTGCCCGAAT TCGATCCCAC CAATCCTCTG TGCCCTGGCG 
0121 TCACCAGACC CAATGGAATC CAAACTCCGG AATATGAGAG CACCTATGTG TTTGAGAACG 
0181 ACTTCCCGGC CCTGGTGGAG GTGGTGCCCG TTCCGCCCAA CAGCGATGAT CCACTGTTCC 
0241 AGATAGCTCC CGCCCGTGGC AACTGCCGAG TGATGTGCTT CCATCCCAAA TCGAATCTGA 
0301 CTTTGCCCAC GATGAGTGCA GCGGAAATCG TCGTTGTTAT CGACGAGTGG ATCAGCCAGT 
0361 TCAACGAGCT TAGCGCCCAA GTACGCGTGG GTGCAGATAT TCGAGAACAA GGGAGCCGCC 
0421 ATGGGGTGTT CCAATCCCCA TCCGCACTGC CAGATCTGGT CATGCTCGTT TCTGCCGACG 
0481 GAACCGCAAC TGAAGCAGGA NC 
 in silico PCR Fragment
0001 CGGCCAA-TG GGTCCTAGTG TGCCCACATC GCACCCAACG CCCTTGGTCG GGTCAGCAGG 
0061 AGAAGGCGCA GAAGAACGAG CTGCCCGAAT TCGATCCCAC CAATCCTCTG TGCCCTGGCG 
0121 TCACCAGACC CAATGGAATC CAAACTCCGG AATATGAGAG CACCTATGTG TTTGAGAACG 
0181 ACTTCCCGGC CCTGGTGGAG GTGGTGCCCG TTCCGCCCAA CAACGATGAT CCACTGTTCC 
0241 AGATAGCTCC CGCCCGTGGC AACTGCCGAG TGATGTGCTT CCATCCCAAA TCGAATCTGA 
0301 CTTTGCCCAC GATGAGTGCA GCGGAAATCG TCGTTGTTAT CGACGAGTGG ATCAGCCAGT 
0361 TCAACGAGCT TAGCG-CCAA GTACGCGTGG GTGCAGATAT TCGAGAACAA GGGAGCCGCC 
0421 ATGGGGTGTT CCAATCCCCA TCCGCACTGC CAGATCTGGT CATGCTCGTT TCTGCCGACG 
0481 GAACCGCAAC TGAAGCAGGA GC 
 Assemble Data

9232R-2.IR_full       1   CGGCCAANTGGGTCCTAGTGTGCCCACATCGCACCCAACGCCCTTGGTCGGGTCAGCAGG 60
                          ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
9232R-2.in silico     1   CGGCCAA-TGGGTCCTAGTGTGCCCACATCGCACCCAACGCCCTTGGTCGGGTCAGCAGG 60


9232R-2.IR_full       61  AGAAGGCGCAGAAGAACGAGCTGCCCGAATTCGATCCCACCAATCCTCTGTGCCCTGGCG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9232R-2.in silico     61  AGAAGGCGCAGAAGAACGAGCTGCCCGAATTCGATCCCACCAATCCTCTGTGCCCTGGCG 120


9232R-2.IR_full       121 TCACCAGACCCAATGGAATCCAAACTCCGGAATATGAGAGCACCTATGTGTTTGAGAACG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9232R-2.in silico     121 TCACCAGACCCAATGGAATCCAAACTCCGGAATATGAGAGCACCTATGTGTTTGAGAACG 180


9232R-2.IR_full       181 ACTTCCCGGCCCTGGTGGAGGTGGTGCCCGTTCCGCCCAACAGCGATGATCCACTGTTCC 240
                          |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
9232R-2.in silico     181 ACTTCCCGGCCCTGGTGGAGGTGGTGCCCGTTCCGCCCAACAACGATGATCCACTGTTCC 240


9232R-2.IR_full       241 AGATAGCTCCCGCCCGTGGCAACTGCCGAGTGATGTGCTTCCATCCCAAATCGAATCTGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9232R-2.in silico     241 AGATAGCTCCCGCCCGTGGCAACTGCCGAGTGATGTGCTTCCATCCCAAATCGAATCTGA 300


9232R-2.IR_full       301 CTTTGCCCACGATGAGTGCAGCGGAAATCGTCGTTGTTATCGACGAGTGGATCAGCCAGT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9232R-2.in silico     301 CTTTGCCCACGATGAGTGCAGCGGAAATCGTCGTTGTTATCGACGAGTGGATCAGCCAGT 360


9232R-2.IR_full       361 TCAACGAGCTTAGCGCCCAAGTACGCGTGGGTGCAGATATTCGAGAACAAGGGAGCCGCC 420
                          ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
9232R-2.in silico     361 TCAACGAGCTTAGCG-CCAAGTACGCGTGGGTGCAGATATTCGAGAACAAGGGAGCCGCC 420


9232R-2.IR_full       421 ATGGGGTGTTCCAATCCCCATCCGCACTGCCAGATCTGGTCATGCTCGTTTCTGCCGACG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9232R-2.in silico     421 ATGGGGTGTTCCAATCCCCATCCGCACTGCCAGATCTGGTCATGCTCGTTTCTGCCGACG 480


9232R-2.IR_full       481 GAACCGCAACTGAAGCAGGANC 502
                          |||||||||||||||||||| |
9232R-2.in silico     481 GAACCGCAACTGAAGCAGGAGC 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135218.2  CG9232-RA (CG9232), mRNA 
0   NM_143453.1  CG7582-RA (CG7582), mRNA 
0   NM_135876.1  CG4697-RA (CSN1a), mRNA 
0   NM_206391.1  CG33256-RA (CG33256), mRNA 
0   NM_142170.2  CG6687-RA (CG6687), mRNA 
0   NM_133004.1  CG8211-RA (CG8211), mRNA 
0   NM_058037.3  CG9677-RA (Int6), mRNA 
0   NM_080319.3  CG4125-RA (rst), mRNA 
0   NM_176195.1  CG33017-RB (CG33017), mRNA 
0   NM_130678.2  CG14419-RA (CG14419), mRNA 
0   NM_143046.2  CG5814-RA (CycB3), mRNA 
0   12  NM_078684.2  CG3291-RA (pcm), mRNA 
0   NM_141316.1  CG1347-RA, transcript variant A (CG1347), mRNA 
0   NM_206434.1  CG1347-RB, transcript variant B (CG1347), mRNA 
0   NM_130550.2  CG11417-RA (CG11417), mRNA 
0   NM_001014549.1  CG4527-RE, transcript variant E (slik), mRNA 
0   NM_166669.1  CG4527-RB, transcript variant B (slik), mRNA 
0   NM_206214.1  CG4527-RC, transcript variant C (slik), mRNA 
0   NM_206213.1  CG4527-RD, transcript variant D (slik), mRNA 
0   NM_132476.2  CG1657-RA (CG1657), mRNA 
0   NM_138064.2  CG4527-RA, transcript variant A (slik), mRNA 
0   NM_142562.1  CG6231-RA, transcript variant A (CG6231), mRNA 
0   NM_141334.1  CG10979-RA (CG10979), mRNA 
0   NM_132220.2  CG2263-RA (CG2263), mRNA 
0   NM_137398.1  CG4954-RA (eIF3-S8), mRNA 
0   16  NM_133159.1  CG14200-RA (CG14200), mRNA 
0   NM_143633.1  CG2187-RA (CG2187), mRNA 
0   NM_132068.1  CG15899-RB (Ca-alpha1T), mRNA 
0   NM_205915.1  CG9526-RB, transcript variant B (CG9526), mRNA 
0   NM_135185.2  CG9526-RA, transcript variant A (CG9526), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.