National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9232R-1 
 Symbol CG9232  Full Name CG9232 
 CG No CG9232  Old CG No CG9232 
 Synonyms CG9232 
 Accession No (Link to NCBI) NM_135218.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CGGCCAA-TGGGTCCTAGTGTGCCCACATCGCACCCAACGCCCTTGGTCGGGTCAGCAGG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AGAAGGCGCAGAAGAACGAGCTGCCCGAATTCGATCCCACCAATCCTCTGTGCCCTGGCG 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TCACCAGACCCAATGGAATCCAAACTCCGGAATATGAGAGCACCTATGTGTTTGAGAACG 180

                          |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| silico     181 ACTTCCCGGCCCTGGTGGAGGTGGTGCCCGTTCCGCCCAACAACGATGATCCACTGTTCC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AGATAGCTCCCGCCCGTGGCAACTGCCGAGTGATGTGCTTCCATCCCAAATCGAATCTGA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CTTTGCCCACGATGAGTGCAGCGGAAATCGTCGTTGTTATCGACGAGTGGATCAGCCAGT 360

                          ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| silico     361 TCAACGAGCTTAGCG-CCAAGTACGCGTGGGTGCAGATATTCGAGAACAAGGGAGCCGCC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ATGGGGTGTTCCAATCCCCATCCGCACTGCCAGATCTGGTCATGCTCGTTTCTGCCGACG 480

9232R-1.IR_full       481 GAACCGCAACTGAAGCAGGANC 502
                          |||||||||||||||||||| | silico     481 GAACCGCAACTGAAGCAGGAGC 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135218.2  CG9232-RA (CG9232), mRNA 
0   NM_143453.1  CG7582-RA (CG7582), mRNA 
0   NM_135876.1  CG4697-RA (CSN1a), mRNA 
0   NM_206391.1  CG33256-RA (CG33256), mRNA 
0   NM_142170.2  CG6687-RA (CG6687), mRNA 
0   NM_133004.1  CG8211-RA (CG8211), mRNA 
0   NM_058037.3  CG9677-RA (Int6), mRNA 
0   NM_080319.3  CG4125-RA (rst), mRNA 
0   NM_176195.1  CG33017-RB (CG33017), mRNA 
0   NM_130678.2  CG14419-RA (CG14419), mRNA 
0   NM_143046.2  CG5814-RA (CycB3), mRNA 
0   12  NM_078684.2  CG3291-RA (pcm), mRNA 
0   NM_141316.1  CG1347-RA, transcript variant A (CG1347), mRNA 
0   NM_206434.1  CG1347-RB, transcript variant B (CG1347), mRNA 
0   NM_130550.2  CG11417-RA (CG11417), mRNA 
0   NM_001014549.1  CG4527-RE, transcript variant E (slik), mRNA 
0   NM_166669.1  CG4527-RB, transcript variant B (slik), mRNA 
0   NM_206214.1  CG4527-RC, transcript variant C (slik), mRNA 
0   NM_206213.1  CG4527-RD, transcript variant D (slik), mRNA 
0   NM_132476.2  CG1657-RA (CG1657), mRNA 
0   NM_138064.2  CG4527-RA, transcript variant A (slik), mRNA 
0   NM_142562.1  CG6231-RA, transcript variant A (CG6231), mRNA 
0   NM_141334.1  CG10979-RA (CG10979), mRNA 
0   NM_132220.2  CG2263-RA (CG2263), mRNA 
0   NM_137398.1  CG4954-RA (eIF3-S8), mRNA 
0   16  NM_133159.1  CG14200-RA (CG14200), mRNA 
0   NM_143633.1  CG2187-RA (CG2187), mRNA 
0   NM_132068.1  CG15899-RB (Ca-alpha1T), mRNA 
0   NM_205915.1  CG9526-RB, transcript variant B (CG9526), mRNA 
0   NM_135185.2  CG9526-RA, transcript variant A (CG9526), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.