National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9227Ra-2 
 Symbol tctn  Full Name tectonic 
 CG No CG9227  Old CG No CG9227 
 Synonyms CG9227,CG42731,tctn,tectonic,Tectonic 
 Accession No (Link to NCBI) NM_135154.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
 
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGAGGTGCACATAATCGGGCAG 
 Primer Seq. 3'
aatctagaggtaccTATGTGGCCAGGCACAGGACG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GAGGTGCACA TAATCGGGCA GATATTGAAA GCTGTTGACT TTGCCGAGCC GCATCTGTAC 
0061 TGCAAGTGGA GTCTGCAGAG CGGAAACCNC TGGCGCCTGG TTCAGGGCGA GGTTCAGGGT 
0121 CAGAGCCACG TGGCGTCCCA CCGGCTCCAG AGCAGCTCGG ATTTCGCGCA GCCGCTGGAC 
0181 ATTCATCTGA GCACCGCATC TGTCCAGGGC TGGCCCC-GC CTGCTAGTGG AAGTGTACGC 
0241 CGTTAACGTA CTGCAACAGT CCTGGGCCGT TGGCTAC-GG CTTTGTGCAC GTACCGTCCA 
0301 CACCAGGCAC CCATCGCCTG GAGATCGGCA CCTGGAAGGT TGCTCCCAAC GGCTTGTGGC 
0361 AGTCGCTGCG TGAGCGTTTC GGAGGCGGAG GAGCGGCCCT CAGCAAGACG GATCTGCTCT 
0421 ACTCGGGTGT TGAGCGTTAC AAGTTACAAA CTCTGAGTTC TGGAAAGGTC ATTGTTGAGC 
0481 TAAACCTAAT CTTTCGAAAG TTCGACGAAT ACGGCGTGGA GTTCAAGTAG CCATGAANGA 
0541 AGTGTTGCNA CTAGTCGTCC TGTNCCTGGC CACATA 
 in silico PCR Fragment
0001 GAGGTGCACA TAATCGGGCA GATATTGAAA GCTGTTGACT TTGCCGAGCC GCATCTGTAC 
0061 TGCAAGTGGA GTCTGCAGAG CGGAAACGCC TGGCGCCTGG TTCAGGGCGA GGTTCAGGGT 
0121 CAGAGCCACG TGGCGTCCCA CCGGCTCCAG AGCAGCTCGG ATTTCGCGCA GCCGCTGGAC 
0181 ATTCATCTGA GCACCGCATC TGTCCAGGGC TGGCCCCGCC TGCTAGTGGA AGTGTACGCC 
0241 GTTAACGTAC TGCAACAGTC CTGGCCCGTT GGCTACGGCT TTGTGCACGT ACCGTCCACA 
0301 CCAGGCACCC ATCGCCTGGA GATCGGCACC TGGAAGGTTG CTCCCAACGG CTTGTGGCAG 
0361 TCGCTGCGTG AGCGTTTCGG AGGCGGAGGA GCGGCCCTCA GCAAGACGGA TCTGCTCTAC 
0421 TCGGTTCGAC GAATACGGCG TGGAGTTCAA GTAGCCATGA AGGAAGTGTT GCCACTAGTC 
0481 GTCCTGTGCC TGGCCACATA  
 Assemble Data

9227Ra-2.IR full       1   GAGGTGCACATAATCGGGCAGATATTGAAAGCTGTTGACTTTGCCGAGCCGCATCTGTAC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9227Ra-2.in silico     1   GAGGTGCACATAATCGGGCAGATATTGAAAGCTGTTGACTTTGCCGAGCCGCATCTGTAC 60


9227Ra-2.IR full       61  TGCAAGTGGAGTCTGCAGAGCGGAAACCNCTGGCGCCTGGTTCAGGGCGAGGTTCAGGGT 120
                           |||||||||||||||||||||||||||  |||||||||||||||||||||||||||||||
9227Ra-2.in silico     61  TGCAAGTGGAGTCTGCAGAGCGGAAACGCCTGGCGCCTGGTTCAGGGCGAGGTTCAGGGT 120


9227Ra-2.IR full       121 CAGAGCCACGTGGCGTCCCACCGGCTCCAGAGCAGCTCGGATTTCGCGCAGCCGCTGGAC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9227Ra-2.in silico     121 CAGAGCCACGTGGCGTCCCACCGGCTCCAGAGCAGCTCGGATTTCGCGCAGCCGCTGGAC 180


9227Ra-2.IR full       181 ATTCATCTGAGCACCGCATCTGTCCAGGGCTGGCCCC-GCCTGCTAGTGGAAGTGTACGC 240
                           ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
9227Ra-2.in silico     181 ATTCATCTGAGCACCGCATCTGTCCAGGGCTGGCCCC-GCCTGCTAGTGGAAGTGTACGC 240


9227Ra-2.IR full       241 CGTTAACGTACTGCAACAGTCCTGGGCCGTTGGCTAC-GGCTTTGTGCACGTACCGTCCA 300
                           ||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||
9227Ra-2.in silico     241 CGTTAACGTACTGCAACAGTCCTGGCCCGTTGGCTAC-GGCTTTGTGCACGTACCGTCCA 300


9227Ra-2.IR full       301 CACCAGGCACCCATCGCCTGGAGATCGGCACCTGGAAGGTTGCTCCCAACGGCTTGTGGC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9227Ra-2.in silico     301 CACCAGGCACCCATCGCCTGGAGATCGGCACCTGGAAGGTTGCTCCCAACGGCTTGTGGC 360


9227Ra-2.IR full       361 AGTCGCTGCGTGAGCGTTTCGGAGGCGGAGGAGCGGCCCTCAGCAAGACGGATCTGCTCT 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
9227Ra-2.in silico     361 AGTCGCTGCGTGAGCGTTTCGGAGGCGGAGGAGCGGCCCTCAGCAAGACGGATCTGCTCT 420


9227Ra-2.IR full       421 ACTCGGGTGTTGAGCGTTACAAGTTACAAACTCTGAGTTCTGGAAAGGTCATTGTTGAGC 480
                           ||||||                                                      
9227Ra-2.in silico     421 ACTCGG------------------------------------------------------ 480


9227Ra-2.IR full       481 TAAACCTAATCTTTCGAAAGTTCGACGAATACGGCGTGGAGTTCAAGTAGCCATGAANGA 540
                                               ||||||||||||||||||||||||||||||||||||| ||
9227Ra-2.in silico     481 --------------------TTCGACGAATACGGCGTGGAGTTCAAGTAGCCATGAAGGA 540


9227Ra-2.IR full       541 AGTGTTGCNACTAGTCGTCCTGTNCCTGGCCACATA 576
                           |||||||| |||||||||||||| ||||||||||||
9227Ra-2.in silico     541 AGTGTTGCCACTAGTCGTCCTGTGCCTGGCCACATA 576

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135154.1  CG9227-RA (tectonic), mRNA 
0.2   NM_135764.3  CG5287-RA (CG5287), mRNA 
0   NM_080018.1  CG6890-RA (Tollo), mRNA 
0   NM_166280.1  CG5170-RD, transcript variant D (Dp1), mRNA 
0   NM_166281.1  CG5170-RE, transcript variant E (Dp1), mRNA 
0   NM_166282.1  CG5170-RF, transcript variant F (Dp1), mRNA 
0   NM_206164.1  CG5170-RA, transcript variant A (Dp1), mRNA 
0   NM_079057.2  CG5170-RC, transcript variant C (Dp1), mRNA 
0   NM_206163.1  CG5170-RB, transcript variant B (Dp1), mRNA 
0   NM_143190.1  CG8966-RA (CG8966), mRNA 
0   NM_141654.1  CG16790-RA (CG16790), mRNA 
0   NM_132519.1  CG9369-RA (m), mRNA 
0   NM_057391.3  CG1977-RA (alpha-Spec), mRNA 
0   NM_140033.1  CG4684-RA (nwk), mRNA 
0   NM_166873.1  CG3638-RB, transcript variant B (CG3638), mRNA 
0   NM_166872.1  CG3638-RD, transcript variant D (CG3638), mRNA 
0   NM_130541.3  CG3638-RC, transcript variant C (CG3638), mRNA 
0   NM_166874.1  CG3638-RA, transcript variant A (CG3638), mRNA 
0   NM_176698.1  CG2977-RB, transcript variant B (inx7), mRNA 
0   NM_176699.1  CG2977-RA, transcript variant A (inx7), mRNA 
0   NM_169838.1  CG14296-RA, transcript variant A (endoA), mRNA 
0   NM_135041.2  CG3756-RA (CG3756), mRNA 
0   NM_138767.2  CG14296-RB, transcript variant B (endoA), mRNA 
0   NM_057258.2  CG10699-RA, transcript variant A (Lim3), mRNA 
0   NM_165277.1  CG10699-RB, transcript variant B (Lim3), mRNA 
0   NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
0   NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
0   NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
0   NM_001038883.1  CG33988-RA (CG33988), mRNA 
0   NM_001015351.1  CG41098-PA.3 (CG41098), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.