National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 9227Ra-1 
 Symbol tctn  Full Name tectonic 
 CG No CG9227  Old CG No CG9227 
 Synonyms CG9227,CG42731,tctn,tectonic,Tectonic 
 Accession No (Link to NCBI) NM_135154.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GAGGTGCACATAATCGGGCAGATATTGAAAGCTGTTGACTTTGCCGAGCCGCATCTGTAC 60

                           |||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||| silico     61  TGCAAGTGGAGTCTGCAGAGCGGAAACGCCTGGCGCCTGGTTCAGGGCGAGGTTCAGGGT 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CAGAGCCACGTGGCGTCCCACCGGCTCCAGAGCAGCTCGGATTTCGCGCAGCCGCTGGAC 180

                           ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| silico     181 ATTCATCTGAGCACCGCATCTGTCCAGGGCTGGCCCC-GCCTGCTAGTGGAAGTGTACGC 240

                           ||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| silico     241 CGTTAACGTACTGCAACAGTCCTGGCCCGTTGGCTAC-GGCTTTGTGCACGTACCGTCCA 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CACCAGGCACCCATCGCCTGGAGATCGGCACCTGGAAGGTTGCTCCCAACGGCTTGTGGC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AGTCGCTGCGTGAGCGTTTCGGAGGCGGAGGAGCGGCCCTCAGCAAGACGGATCTGCTCT 420

                           ||||||                                              silico     421 ACTCGG------------------------------------------------------ 480

                                               ||||||||||||||||||||||||||||||||||||| || silico     481 --------------------TTCGACGAATACGGCGTGGAGTTCAAGTAGCCATGAAGGA 540

                           |||||||| |||||||||||||| |||||||||||| silico     541 AGTGTTGCCACTAGTCGTCCTGTGCCTGGCCACATA 576

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135154.1  CG9227-RA (tectonic), mRNA 
0.2   NM_135764.3  CG5287-RA (CG5287), mRNA 
0   NM_080018.1  CG6890-RA (Tollo), mRNA 
0   NM_166280.1  CG5170-RD, transcript variant D (Dp1), mRNA 
0   NM_166281.1  CG5170-RE, transcript variant E (Dp1), mRNA 
0   NM_166282.1  CG5170-RF, transcript variant F (Dp1), mRNA 
0   NM_206164.1  CG5170-RA, transcript variant A (Dp1), mRNA 
0   NM_079057.2  CG5170-RC, transcript variant C (Dp1), mRNA 
0   NM_206163.1  CG5170-RB, transcript variant B (Dp1), mRNA 
0   NM_143190.1  CG8966-RA (CG8966), mRNA 
0   NM_141654.1  CG16790-RA (CG16790), mRNA 
0   NM_132519.1  CG9369-RA (m), mRNA 
0   NM_057391.3  CG1977-RA (alpha-Spec), mRNA 
0   NM_140033.1  CG4684-RA (nwk), mRNA 
0   NM_166873.1  CG3638-RB, transcript variant B (CG3638), mRNA 
0   NM_166872.1  CG3638-RD, transcript variant D (CG3638), mRNA 
0   NM_130541.3  CG3638-RC, transcript variant C (CG3638), mRNA 
0   NM_166874.1  CG3638-RA, transcript variant A (CG3638), mRNA 
0   NM_176698.1  CG2977-RB, transcript variant B (inx7), mRNA 
0   NM_176699.1  CG2977-RA, transcript variant A (inx7), mRNA 
0   NM_169838.1  CG14296-RA, transcript variant A (endoA), mRNA 
0   NM_135041.2  CG3756-RA (CG3756), mRNA 
0   NM_138767.2  CG14296-RB, transcript variant B (endoA), mRNA 
0   NM_057258.2  CG10699-RA, transcript variant A (Lim3), mRNA 
0   NM_165277.1  CG10699-RB, transcript variant B (Lim3), mRNA 
0   NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
0   NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
0   NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
0   NM_001038883.1  CG33988-RA (CG33988), mRNA 
0   NM_001015351.1  CG41098-PA.3 (CG41098), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.